Incidental Mutation 'R1649:BC034090'
ID174071
Institutional Source Beutler Lab
Gene Symbol BC034090
Ensembl Gene ENSMUSG00000033722
Gene NamecDNA sequence BC034090
Synonyms
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1649 (G1)
Quality Score172
Status Not validated
Chromosome1
Chromosomal Location155212471-155244444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155225573 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 315 (H315R)
Ref Sequence ENSEMBL: ENSMUSP00000037456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035914] [ENSMUST00000186156] [ENSMUST00000187096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035914
AA Change: H315R

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037456
Gene: ENSMUSG00000033722
AA Change: H315R

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:DUF4685 44 168 6.6e-57 PFAM
low complexity region 486 500 N/A INTRINSIC
low complexity region 562 568 N/A INTRINSIC
low complexity region 640 652 N/A INTRINSIC
PDZ 830 905 4.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186082
Predicted Effect probably benign
Transcript: ENSMUST00000186156
AA Change: H677R

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139623
Gene: ENSMUSG00000033722
AA Change: H677R

DomainStartEndE-ValueType
low complexity region 446 463 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 855 861 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
PDZ 1123 1198 2.2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186551
Predicted Effect probably benign
Transcript: ENSMUST00000187096
SMART Domains Protein: ENSMUSP00000140632
Gene: ENSMUSG00000033722

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190976
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in BC034090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:BC034090 APN 1 155225447 missense possibly damaging 0.95
IGL00159:BC034090 APN 1 155225451 nonsense probably null
IGL00481:BC034090 APN 1 155232521 missense probably benign 0.04
IGL01309:BC034090 APN 1 155226384 missense probably damaging 0.98
IGL01813:BC034090 APN 1 155226339 nonsense probably null
IGL01938:BC034090 APN 1 155232592 splice site probably null
IGL01982:BC034090 APN 1 155223332 missense probably damaging 1.00
IGL02115:BC034090 APN 1 155232651 intron probably benign
IGL02338:BC034090 APN 1 155217471 missense probably damaging 1.00
IGL02406:BC034090 APN 1 155225153 missense probably benign 0.00
IGL03243:BC034090 APN 1 155225655 missense possibly damaging 0.71
IGL03290:BC034090 APN 1 155226110 missense probably damaging 1.00
R0055:BC034090 UTSW 1 155241658 missense probably damaging 1.00
R1436:BC034090 UTSW 1 155225916 missense probably benign 0.04
R1710:BC034090 UTSW 1 155225864 missense possibly damaging 0.82
R1819:BC034090 UTSW 1 155225829 missense possibly damaging 0.58
R1969:BC034090 UTSW 1 155225226 missense possibly damaging 0.90
R1996:BC034090 UTSW 1 155221594 unclassified probably benign
R2012:BC034090 UTSW 1 155221432 missense probably damaging 0.98
R2133:BC034090 UTSW 1 155225786 missense probably benign 0.27
R3426:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3427:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3428:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3782:BC034090 UTSW 1 155226278 missense probably damaging 1.00
R3792:BC034090 UTSW 1 155241797 missense probably damaging 0.98
R4234:BC034090 UTSW 1 155241580 missense probably benign
R4373:BC034090 UTSW 1 155226158 missense probably benign 0.22
R4377:BC034090 UTSW 1 155232450 missense probably benign 0.00
R4661:BC034090 UTSW 1 155232475 missense probably damaging 0.98
R4676:BC034090 UTSW 1 155226264 missense possibly damaging 0.60
R4729:BC034090 UTSW 1 155225090 missense probably damaging 1.00
R5170:BC034090 UTSW 1 155213650 missense probably damaging 1.00
R5340:BC034090 UTSW 1 155226414 missense possibly damaging 0.74
R5382:BC034090 UTSW 1 155225603 missense probably benign 0.09
R5384:BC034090 UTSW 1 155242027 missense possibly damaging 0.68
R5576:BC034090 UTSW 1 155241468 missense probably benign 0.01
R5891:BC034090 UTSW 1 155233047 unclassified probably benign
R6060:BC034090 UTSW 1 155241499 missense probably benign 0.00
R6092:BC034090 UTSW 1 155224913 missense probably damaging 0.99
R6662:BC034090 UTSW 1 155226339 missense possibly damaging 0.92
R6736:BC034090 UTSW 1 155241930 missense possibly damaging 0.92
R6903:BC034090 UTSW 1 155221385 missense probably benign 0.03
R6970:BC034090 UTSW 1 155241439 missense probably damaging 1.00
R7144:BC034090 UTSW 1 155242031 missense probably damaging 1.00
R7201:BC034090 UTSW 1 155241934 missense probably damaging 0.98
R7265:BC034090 UTSW 1 155225327 missense probably damaging 0.96
R7380:BC034090 UTSW 1 155232483 missense probably damaging 1.00
R7436:BC034090 UTSW 1 155226381 missense probably damaging 1.00
R7569:BC034090 UTSW 1 155217405 missense probably benign 0.00
R7587:BC034090 UTSW 1 155217486 missense probably damaging 1.00
R7664:BC034090 UTSW 1 155241631 missense probably damaging 1.00
X0002:BC034090 UTSW 1 155226279 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGGAAAACGGCACAGCATAAGC -3'
(R):5'- ATTCCCAGGGCTCCACACAGAATG -3'

Sequencing Primer
(F):5'- CATAAGCTGTCCTGCATGGAG -3'
(R):5'- AGGACCTCTCAGTCTAGCAG -3'
Posted On2014-04-24