Incidental Mutation 'R1649:Gm1527'
ID174076
Institutional Source Beutler Lab
Gene Symbol Gm1527
Ensembl Gene ENSMUSG00000074655
Gene Namepredicted gene 1527
SynonymsLOC385263
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1649 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location28892617-28926724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28898731 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 60 (I60T)
Ref Sequence ENSEMBL: ENSMUSP00000096773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099170]
Predicted Effect probably damaging
Transcript: ENSMUST00000099170
AA Change: I60T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096773
Gene: ENSMUSG00000074655
AA Change: I60T

DomainStartEndE-ValueType
PH 16 119 2.37e-6 SMART
Pfam:RA 125 214 1.7e-8 PFAM
RhoGAP 300 471 2.8e-29 SMART
transmembrane domain 623 645 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Gm1527
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Gm1527 APN 3 28895588 utr 5 prime probably benign
IGL02069:Gm1527 APN 3 28926614 missense possibly damaging 0.53
IGL02794:Gm1527 APN 3 28895680 missense unknown
IGL03285:Gm1527 APN 3 28920417 missense probably damaging 1.00
PIT4403001:Gm1527 UTSW 3 28917985 missense possibly damaging 0.82
R0316:Gm1527 UTSW 3 28915774 missense probably damaging 1.00
R0487:Gm1527 UTSW 3 28926679 missense probably benign 0.00
R1411:Gm1527 UTSW 3 28914483 missense probably benign 0.04
R1458:Gm1527 UTSW 3 28918050 missense possibly damaging 0.52
R1470:Gm1527 UTSW 3 28915268 missense possibly damaging 0.82
R1470:Gm1527 UTSW 3 28915268 missense possibly damaging 0.82
R1476:Gm1527 UTSW 3 28926556 missense probably benign 0.19
R1523:Gm1527 UTSW 3 28920418 missense probably damaging 1.00
R1613:Gm1527 UTSW 3 28898853 critical splice donor site probably null
R1722:Gm1527 UTSW 3 28921634 missense probably benign 0.10
R1760:Gm1527 UTSW 3 28895550 splice site probably benign
R1857:Gm1527 UTSW 3 28903390 missense probably damaging 0.99
R1981:Gm1527 UTSW 3 28915835 critical splice donor site probably null
R2063:Gm1527 UTSW 3 28926647 missense probably benign 0.04
R2080:Gm1527 UTSW 3 28926661 missense probably benign 0.01
R2115:Gm1527 UTSW 3 28917949 missense probably benign 0.00
R2440:Gm1527 UTSW 3 28895615 missense probably damaging 0.98
R3799:Gm1527 UTSW 3 28926596 missense possibly damaging 0.53
R4012:Gm1527 UTSW 3 28898820 missense probably benign 0.04
R4132:Gm1527 UTSW 3 28920630 missense probably benign 0.37
R4234:Gm1527 UTSW 3 28914366 missense probably damaging 1.00
R4406:Gm1527 UTSW 3 28895725 missense possibly damaging 0.81
R4528:Gm1527 UTSW 3 28914393 missense probably damaging 0.99
R4567:Gm1527 UTSW 3 28914407 missense probably damaging 0.99
R4795:Gm1527 UTSW 3 28920663 missense possibly damaging 0.56
R4796:Gm1527 UTSW 3 28920663 missense possibly damaging 0.56
R5127:Gm1527 UTSW 3 28903418 missense probably damaging 1.00
R5774:Gm1527 UTSW 3 28918090 missense probably benign 0.22
R5890:Gm1527 UTSW 3 28915395 missense probably benign 0.03
R6024:Gm1527 UTSW 3 28920603 missense probably benign 0.10
R7092:Gm1527 UTSW 3 28914547 critical splice donor site probably null
R7128:Gm1527 UTSW 3 28915311 missense possibly damaging 0.95
R7197:Gm1527 UTSW 3 28926541 missense probably null 0.00
R7308:Gm1527 UTSW 3 28902280 missense probably benign 0.02
R7360:Gm1527 UTSW 3 28914542 nonsense probably null
R7380:Gm1527 UTSW 3 28920472 missense probably benign 0.10
R7566:Gm1527 UTSW 3 28920618 missense probably benign 0.02
R7864:Gm1527 UTSW 3 28926470 missense probably benign 0.01
R7896:Gm1527 UTSW 3 28921593 splice site probably null
R8261:Gm1527 UTSW 3 28920600 missense probably damaging 1.00
R8300:Gm1527 UTSW 3 28926595 missense possibly damaging 0.96
X0021:Gm1527 UTSW 3 28920468 missense probably damaging 1.00
X0028:Gm1527 UTSW 3 28914500 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGGCTACCTCTATTTGTGAGCACTG -3'
(R):5'- GCTCTCTTCCTGTGAATACAAGCCC -3'

Sequencing Primer
(F):5'- CCTCTATTTGTGAGCACTGAGAAG -3'
(R):5'- CAAACTGTAGGTCTTACCGAAAG -3'
Posted On2014-04-24