Incidental Mutation 'R1649:Rtp3'
ID174108
Institutional Source Beutler Lab
Gene Symbol Rtp3
Ensembl Gene ENSMUSG00000066319
Gene Namereceptor transporter protein 3
SynonymsTmem7
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1649 (G1)
Quality Score93
Status Not validated
Chromosome9
Chromosomal Location110984935-110990583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110986704 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 198 (T198A)
Ref Sequence ENSEMBL: ENSMUSP00000081985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035076] [ENSMUST00000084922] [ENSMUST00000198702] [ENSMUST00000199891]
Predicted Effect probably benign
Transcript: ENSMUST00000035076
SMART Domains Protein: ENSMUSP00000035076
Gene: ENSMUSG00000032495

DomainStartEndE-ValueType
Blast:LRR 143 165 5e-7 BLAST
LRR_TYP 166 189 4.87e-4 SMART
LRR 236 258 1.41e1 SMART
LRR 259 282 2.27e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084922
AA Change: T198A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000081985
Gene: ENSMUSG00000066319
AA Change: T198A

DomainStartEndE-ValueType
zf-3CxxC 52 164 2.13e-52 SMART
low complexity region 356 404 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197321
Predicted Effect probably benign
Transcript: ENSMUST00000198702
SMART Domains Protein: ENSMUSP00000143100
Gene: ENSMUSG00000066319

DomainStartEndE-ValueType
Pfam:zf-3CxxC 52 81 2.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199891
SMART Domains Protein: ENSMUSP00000143305
Gene: ENSMUSG00000066319

DomainStartEndE-ValueType
zf-3CxxC 52 164 2.13e-52 SMART
low complexity region 356 404 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Rtp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Rtp3 APN 9 110986598 missense probably benign 0.03
IGL02212:Rtp3 APN 9 110987321 splice site probably benign
IGL03033:Rtp3 APN 9 110986094 unclassified probably benign
R0392:Rtp3 UTSW 9 110989553 missense probably damaging 0.98
R0529:Rtp3 UTSW 9 110987084 missense possibly damaging 0.93
R0645:Rtp3 UTSW 9 110987100 missense probably damaging 0.97
R1282:Rtp3 UTSW 9 110986920 missense probably benign 0.01
R1609:Rtp3 UTSW 9 110986017 unclassified probably benign
R1662:Rtp3 UTSW 9 110986683 missense probably benign 0.23
R2011:Rtp3 UTSW 9 110986034 unclassified probably benign
R3697:Rtp3 UTSW 9 110987194 missense possibly damaging 0.86
R4661:Rtp3 UTSW 9 110986451 unclassified probably null
R4707:Rtp3 UTSW 9 110986211 unclassified probably benign
R4764:Rtp3 UTSW 9 110987350 intron probably benign
R4796:Rtp3 UTSW 9 110986454 missense probably benign 0.00
R4839:Rtp3 UTSW 9 110989476 missense probably damaging 1.00
R5262:Rtp3 UTSW 9 110986127 unclassified probably benign
R5886:Rtp3 UTSW 9 110987136 missense probably damaging 1.00
R5932:Rtp3 UTSW 9 110986692 missense probably benign 0.04
R6089:Rtp3 UTSW 9 110986973 missense probably benign 0.00
R6545:Rtp3 UTSW 9 110986826 missense possibly damaging 0.83
R6812:Rtp3 UTSW 9 110987112 missense probably benign 0.14
R6895:Rtp3 UTSW 9 110987196 missense possibly damaging 0.72
R7023:Rtp3 UTSW 9 110986646 missense probably benign 0.00
R7113:Rtp3 UTSW 9 110986699 missense probably damaging 0.98
R7167:Rtp3 UTSW 9 110986704 missense probably benign 0.01
R7171:Rtp3 UTSW 9 110985941 missense unknown
R7359:Rtp3 UTSW 9 110986296 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTTGAATGACACATGTAGGGGCAGG -3'
(R):5'- AGCAACATTTCCTCCTCACGGC -3'

Sequencing Primer
(F):5'- GATGGTTTTGAGGTACAGCTAATC -3'
(R):5'- TCACGGCCCTCCTCTAAAG -3'
Posted On2014-04-24