Incidental Mutation 'R1649:Zfp759'
ID174121
Institutional Source Beutler Lab
Gene Symbol Zfp759
Ensembl Gene ENSMUSG00000057396
Gene Namezinc finger protein 759
SynonymsRslcan-8
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1649 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67121660-67141787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67139604 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 406 (N406K)
Ref Sequence ENSEMBL: ENSMUSP00000049650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052716] [ENSMUST00000224346]
Predicted Effect probably benign
Transcript: ENSMUST00000052716
AA Change: N406K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000049650
Gene: ENSMUSG00000057396
AA Change: N406K

DomainStartEndE-ValueType
KRAB 5 65 1.6e-22 SMART
ZnF_C2H2 106 128 5.54e1 SMART
ZnF_C2H2 162 184 3.83e-2 SMART
ZnF_C2H2 190 212 1.82e-3 SMART
ZnF_C2H2 218 240 1.64e-1 SMART
ZnF_C2H2 246 268 1.67e-2 SMART
ZnF_C2H2 274 296 1.95e-3 SMART
ZnF_C2H2 302 324 1.84e-4 SMART
ZnF_C2H2 330 352 7.78e-3 SMART
ZnF_C2H2 358 380 1.6e-4 SMART
ZnF_C2H2 386 408 1.67e-2 SMART
ZnF_C2H2 414 436 4.87e-4 SMART
ZnF_C2H2 442 464 3.39e-3 SMART
ZnF_C2H2 498 520 2.57e-3 SMART
ZnF_C2H2 526 548 8.47e-4 SMART
ZnF_C2H2 554 576 2.02e-1 SMART
ZnF_C2H2 582 604 2.53e-2 SMART
ZnF_C2H2 610 632 4.79e-3 SMART
ZnF_C2H2 638 660 1.84e-4 SMART
ZnF_C2H2 666 688 1.36e-2 SMART
ZnF_C2H2 694 716 4.17e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223605
Predicted Effect probably benign
Transcript: ENSMUST00000224346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224426
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Other mutations in Zfp759
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Zfp759 APN 13 67139594 missense probably benign 0.25
IGL03131:Zfp759 APN 13 67138664 missense probably damaging 1.00
IGL03218:Zfp759 APN 13 67139416 missense probably benign 0.00
R0243:Zfp759 UTSW 13 67138813 missense possibly damaging 0.66
R0319:Zfp759 UTSW 13 67140292 missense probably benign 0.00
R0520:Zfp759 UTSW 13 67137355 missense probably benign 0.29
R0961:Zfp759 UTSW 13 67139863 missense probably benign 0.32
R1435:Zfp759 UTSW 13 67138766 missense possibly damaging 0.73
R1880:Zfp759 UTSW 13 67139212 missense probably damaging 1.00
R2118:Zfp759 UTSW 13 67139514 unclassified probably benign
R2170:Zfp759 UTSW 13 67136748 missense possibly damaging 0.88
R3154:Zfp759 UTSW 13 67138655 missense probably benign 0.20
R3551:Zfp759 UTSW 13 67138967 missense probably benign 0.24
R4392:Zfp759 UTSW 13 67139643 nonsense probably null
R4495:Zfp759 UTSW 13 67138925 splice site probably null
R4736:Zfp759 UTSW 13 67139344 missense probably damaging 1.00
R4882:Zfp759 UTSW 13 67139290 missense probably damaging 1.00
R5717:Zfp759 UTSW 13 67138708 missense probably damaging 1.00
R5921:Zfp759 UTSW 13 67140494 missense probably damaging 1.00
R6247:Zfp759 UTSW 13 67140460 missense probably benign 0.00
R6381:Zfp759 UTSW 13 67138905 nonsense probably null
R6427:Zfp759 UTSW 13 67139098 splice site probably null
R6567:Zfp759 UTSW 13 67139086 missense probably benign 0.34
R7140:Zfp759 UTSW 13 67140113 missense possibly damaging 0.92
R7731:Zfp759 UTSW 13 67139626 missense possibly damaging 0.82
R8504:Zfp759 UTSW 13 67138883 missense probably benign 0.00
Z1176:Zfp759 UTSW 13 67136808 missense probably damaging 0.98
Z1177:Zfp759 UTSW 13 67140148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTGAAGAGGTTGGCAAGTCCT -3'
(R):5'- ATGGAGACCAGAAGACCTTTCTACCTAC -3'

Sequencing Primer
(F):5'- gctttccgctctccatcatc -3'
(R):5'- CTACCTACTTTACACTTGGAGGG -3'
Posted On2014-04-24