Mutagenetix > Incidental Mutation

Incidental Mutation 'R1649:Map1b'

174122

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

039685-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1649 (G1)

Quality Score

81.1

Status

Not validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 99516478 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 4 (V4L)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

probably benign
Transcript: ENSMUST00000064762
AA Change: V4L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: V4L

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181939

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223820

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 88.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430078G23Rik	A	G	8: 3,389,094		probably benign	Het
Akr1a1	T	A	4: 116,638,020	I261F	probably damaging	Het
Aldh1l1	T	C	6: 90,564,389	V255A	probably benign	Het
Ambn	T	A	5: 88,464,481	M172K	probably benign	Het
BC034090	T	C	1: 155,225,573	H315R	possibly damaging	Het
Btaf1	T	A	19: 36,981,722	D707E	probably benign	Het
C6	T	C	15: 4,735,257	L145P	possibly damaging	Het
Cav3	T	A	6: 112,472,246	L75Q	probably damaging	Het
Cavin2	T	A	1: 51,300,780	D205E	probably benign	Het
Cdadc1	T	C	14: 59,573,793	T423A	probably damaging	Het
Cep120	A	T	18: 53,724,576	H272Q	probably damaging	Het
Chd9	A	T	8: 90,932,601	Q63L	possibly damaging	Het
Clspn	T	C	4: 126,566,435		probably benign	Het
Cramp1l	G	T	17: 24,983,243	H422N	probably damaging	Het
Csn1s2b	A	T	5: 87,819,084	M71L	probably benign	Het
D630045J12Rik	C	A	6: 38,181,431	A1104S	probably damaging	Het
D930048N14Rik	A	G	11: 51,654,836		probably benign	Het
Ern2	G	A	7: 122,177,400	P366S	probably damaging	Het
Gm1527	T	C	3: 28,898,731	I60T	probably damaging	Het
Gse1	T	C	8: 120,578,515		probably benign	Het
Ildr1	T	C	16: 36,708,319	L42P	probably damaging	Het
Itih2	G	A	2: 10,105,735	T515I	probably benign	Het
Jcad	C	A	18: 4,673,309	P357Q	probably damaging	Het
Kitl	A	G	10: 100,064,114	T94A	probably benign	Het
Klri1	C	T	6: 129,698,241	M185I	probably benign	Het
Lsamp	A	T	16: 41,955,298	M171L	probably benign	Het
Macf1	T	G	4: 123,484,053	I1460L	probably damaging	Het
Mboat7	A	T	7: 3,685,818	V237D	probably benign	Het
Mctp2	A	T	7: 72,161,258	I656K	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Nipsnap2	T	A	5: 129,753,237	I205N	probably damaging	Het
Nsd2	T	C	5: 33,854,640	V264A	probably damaging	Het
Oacyl	C	T	18: 65,750,096	T582I	probably damaging	Het
Olfm1	A	T	2: 28,229,267	T333S	possibly damaging	Het
Olfm4	G	A	14: 80,011,982	E180K	probably damaging	Het
Olfr127	T	C	17: 37,904,169	F208L	probably benign	Het
Olfr1368	A	T	13: 21,142,742	L105Q	probably damaging	Het
Olfr146	T	G	9: 39,019,480	Q20H	probably benign	Het
Parp4	T	A	14: 56,590,428	V212E	possibly damaging	Het
Pcdhb21	T	A	18: 37,515,613	N598K	probably damaging	Het
Piezo2	C	A	18: 63,117,672	W452L	probably benign	Het
Plec	C	A	15: 76,205,811	A110S	possibly damaging	Het
Popdc3	T	C	10: 45,315,224	Y144H	probably damaging	Het
Ptgdr	T	C	14: 44,858,502	H251R	probably benign	Het
Ptpro	T	A	6: 137,444,017	Y246*	probably null	Het
Pyroxd2	T	C	19: 42,738,134	D247G	probably damaging	Het
Robo2	T	C	16: 73,899,001	E1418G	probably benign	Het
Rtp3	T	C	9: 110,986,704	T198A	probably benign	Het
Sec16a	A	T	2: 26,425,524	V1767D	probably damaging	Het
Sept14	T	C	5: 129,697,755	N119D	probably benign	Het
Serpina5	A	T	12: 104,105,225	T364S	possibly damaging	Het
Setd2	A	G	9: 110,549,864	S632G	probably benign	Het
Sh3bp2	C	T	5: 34,559,004	A253V	possibly damaging	Het
Slc6a5	G	T	7: 49,936,262	G443C	probably damaging	Het
Spag9	T	A	11: 94,108,452		probably null	Het
Sptbn1	T	C	11: 30,137,301	E1033G	probably damaging	Het
Timm17a	T	G	1: 135,309,802	Q39P	probably damaging	Het
Tmem26	A	T	10: 68,751,273	T184S	probably damaging	Het
Tpi1	A	T	6: 124,812,928		probably null	Het
Tssk5	T	C	15: 76,373,803	Y118C	possibly damaging	Het
Ttll4	T	A	1: 74,697,470	L1118Q	possibly damaging	Het
Ttll5	T	A	12: 85,923,014	L691Q	probably damaging	Het
Vmn1r49	A	T	6: 90,072,641	H126Q	possibly damaging	Het
Zfp518b	A	T	5: 38,671,881	V927E	probably damaging	Het
Zfp618	T	C	4: 63,095,537	F213S	probably damaging	Het
Zfp759	T	A	13: 67,139,604	N406K	probably benign	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- GACACCTGCATTTCAAAGAGCACG -3'
(R):5'- GCCTAGTCTCCATATAAACGGCACC -3'

Sequencing Primer
(F):5'- CCTATCCCTCAGGGCTATTATAAAG -3'
(R):5'- TATAAACGGCACCGCCTC -3'

Posted On

2014-04-24