Mutagenetix > Incidental Mutation

Incidental Mutation 'R1649:Parp4'

174124

Institutional Source

Beutler Lab

Gene Symbol

Parp4

Ensembl Gene

ENSMUSG00000054509

Gene Name

poly (ADP-ribose) polymerase family, member 4

Synonyms

p193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik

MMRRC Submission

039685-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R1649 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56575619-56659794 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 56590428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 212 (V212E)

Ref Sequence

ENSEMBL: ENSMUSP00000124258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161553]

AlphaFold

E9PYK3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161553
AA Change: V212E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: V212E

Domain	Start	End	E-Value	Type
BRCT	3	84	4.32e-9	SMART
low complexity region	97	104	N/A	INTRINSIC
SCOP:d1a26_1	252	352	2e-19	SMART
Pfam:PARP	371	559	1.8e-50	PFAM
VIT	600	728	1.5e-57	SMART
VWA	867	1030	6.08e-13	SMART
Blast:14_3_3	1149	1205	5e-10	BLAST
low complexity region	1255	1264	N/A	INTRINSIC
low complexity region	1348	1362	N/A	INTRINSIC
low complexity region	1371	1394	N/A	INTRINSIC
internal_repeat_1	1395	1416	4.48e-6	PROSPERO
Pfam:Drf_FH1	1443	1542	3.3e-15	PFAM
low complexity region	1553	1587	N/A	INTRINSIC
internal_repeat_2	1588	1608	2.45e-5	PROSPERO
low complexity region	1695	1708	N/A	INTRINSIC
low complexity region	1739	1750	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 88.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430078G23Rik	A	G	8: 3,389,094		probably benign	Het
Akr1a1	T	A	4: 116,638,020	I261F	probably damaging	Het
Aldh1l1	T	C	6: 90,564,389	V255A	probably benign	Het
Ambn	T	A	5: 88,464,481	M172K	probably benign	Het
BC034090	T	C	1: 155,225,573	H315R	possibly damaging	Het
Btaf1	T	A	19: 36,981,722	D707E	probably benign	Het
C6	T	C	15: 4,735,257	L145P	possibly damaging	Het
Cav3	T	A	6: 112,472,246	L75Q	probably damaging	Het
Cavin2	T	A	1: 51,300,780	D205E	probably benign	Het
Cdadc1	T	C	14: 59,573,793	T423A	probably damaging	Het
Cep120	A	T	18: 53,724,576	H272Q	probably damaging	Het
Chd9	A	T	8: 90,932,601	Q63L	possibly damaging	Het
Clspn	T	C	4: 126,566,435		probably benign	Het
Cramp1l	G	T	17: 24,983,243	H422N	probably damaging	Het
Csn1s2b	A	T	5: 87,819,084	M71L	probably benign	Het
D630045J12Rik	C	A	6: 38,181,431	A1104S	probably damaging	Het
D930048N14Rik	A	G	11: 51,654,836		probably benign	Het
Ern2	G	A	7: 122,177,400	P366S	probably damaging	Het
Gm1527	T	C	3: 28,898,731	I60T	probably damaging	Het
Gse1	T	C	8: 120,578,515		probably benign	Het
Ildr1	T	C	16: 36,708,319	L42P	probably damaging	Het
Itih2	G	A	2: 10,105,735	T515I	probably benign	Het
Jcad	C	A	18: 4,673,309	P357Q	probably damaging	Het
Kitl	A	G	10: 100,064,114	T94A	probably benign	Het
Klri1	C	T	6: 129,698,241	M185I	probably benign	Het
Lsamp	A	T	16: 41,955,298	M171L	probably benign	Het
Macf1	T	G	4: 123,484,053	I1460L	probably damaging	Het
Map1b	C	G	13: 99,516,478	V4L	probably benign	Het
Mboat7	A	T	7: 3,685,818	V237D	probably benign	Het
Mctp2	A	T	7: 72,161,258	I656K	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Nipsnap2	T	A	5: 129,753,237	I205N	probably damaging	Het
Nsd2	T	C	5: 33,854,640	V264A	probably damaging	Het
Oacyl	C	T	18: 65,750,096	T582I	probably damaging	Het
Olfm1	A	T	2: 28,229,267	T333S	possibly damaging	Het
Olfm4	G	A	14: 80,011,982	E180K	probably damaging	Het
Olfr127	T	C	17: 37,904,169	F208L	probably benign	Het
Olfr1368	A	T	13: 21,142,742	L105Q	probably damaging	Het
Olfr146	T	G	9: 39,019,480	Q20H	probably benign	Het
Pcdhb21	T	A	18: 37,515,613	N598K	probably damaging	Het
Piezo2	C	A	18: 63,117,672	W452L	probably benign	Het
Plec	C	A	15: 76,205,811	A110S	possibly damaging	Het
Popdc3	T	C	10: 45,315,224	Y144H	probably damaging	Het
Ptgdr	T	C	14: 44,858,502	H251R	probably benign	Het
Ptpro	T	A	6: 137,444,017	Y246*	probably null	Het
Pyroxd2	T	C	19: 42,738,134	D247G	probably damaging	Het
Robo2	T	C	16: 73,899,001	E1418G	probably benign	Het
Rtp3	T	C	9: 110,986,704	T198A	probably benign	Het
Sec16a	A	T	2: 26,425,524	V1767D	probably damaging	Het
Sept14	T	C	5: 129,697,755	N119D	probably benign	Het
Serpina5	A	T	12: 104,105,225	T364S	possibly damaging	Het
Setd2	A	G	9: 110,549,864	S632G	probably benign	Het
Sh3bp2	C	T	5: 34,559,004	A253V	possibly damaging	Het
Slc6a5	G	T	7: 49,936,262	G443C	probably damaging	Het
Spag9	T	A	11: 94,108,452		probably null	Het
Sptbn1	T	C	11: 30,137,301	E1033G	probably damaging	Het
Timm17a	T	G	1: 135,309,802	Q39P	probably damaging	Het
Tmem26	A	T	10: 68,751,273	T184S	probably damaging	Het
Tpi1	A	T	6: 124,812,928		probably null	Het
Tssk5	T	C	15: 76,373,803	Y118C	possibly damaging	Het
Ttll4	T	A	1: 74,697,470	L1118Q	possibly damaging	Het
Ttll5	T	A	12: 85,923,014	L691Q	probably damaging	Het
Vmn1r49	A	T	6: 90,072,641	H126Q	possibly damaging	Het
Zfp518b	A	T	5: 38,671,881	V927E	probably damaging	Het
Zfp618	T	C	4: 63,095,537	F213S	probably damaging	Het
Zfp759	T	A	13: 67,139,604	N406K	probably benign	Het

Other mutations in Parp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Parp4	APN	14	56616460	missense	possibly damaging	0.82
IGL00571:Parp4	APN	14	56647353	missense	unknown
IGL00737:Parp4	APN	14	56584163	missense	probably damaging	0.99
IGL00793:Parp4	APN	14	56602877	missense	possibly damaging	0.73
IGL01108:Parp4	APN	14	56607440	missense	probably benign	0.01
IGL01131:Parp4	APN	14	56585760	splice site	probably benign
IGL01485:Parp4	APN	14	56622204	missense	possibly damaging	0.54
IGL01704:Parp4	APN	14	56602326	missense	probably damaging	0.99
IGL01993:Parp4	APN	14	56610788	missense	possibly damaging	0.82
IGL02125:Parp4	APN	14	56590502	missense	probably benign	0.33
IGL02851:Parp4	APN	14	56648869	missense	unknown
IGL02863:Parp4	APN	14	56648786	missense	unknown
IGL03065:Parp4	APN	14	56637869	missense	probably benign	0.09
IGL03117:Parp4	APN	14	56602856	missense	probably benign	0.17
IGL03271:Parp4	APN	14	56585625	missense	probably benign	0.10
IGL03309:Parp4	APN	14	56587808	missense	probably benign	0.11
IGL03408:Parp4	APN	14	56602408	missense	probably damaging	0.99
poisonous	UTSW	14	56635748	missense	possibly damaging	0.65
R0515_Parp4_195	UTSW	14	56613667	missense	probably damaging	1.00
toxic	UTSW	14	56629158	missense	probably benign	0.28
venomous	UTSW	14	56589898	missense	possibly damaging	0.92
virulent	UTSW	14	56587778	missense	probably damaging	0.97
R0278:Parp4	UTSW	14	56607523	missense	probably damaging	0.99
R0320:Parp4	UTSW	14	56588496	critical splice donor site	probably null
R0445:Parp4	UTSW	14	56602748	splice site	probably null
R0452:Parp4	UTSW	14	56648843	missense	unknown
R0511:Parp4	UTSW	14	56635715	splice site	probably benign
R0515:Parp4	UTSW	14	56613667	missense	probably damaging	1.00
R0608:Parp4	UTSW	14	56602404	missense	probably damaging	1.00
R0800:Parp4	UTSW	14	56589951	missense	probably benign	0.00
R0959:Parp4	UTSW	14	56648119	missense	unknown
R1207:Parp4	UTSW	14	56647882	missense	unknown
R1207:Parp4	UTSW	14	56647882	missense	unknown
R1342:Parp4	UTSW	14	56590397	missense	probably damaging	1.00
R1520:Parp4	UTSW	14	56598406	missense	probably damaging	1.00
R1565:Parp4	UTSW	14	56589872	splice site	probably benign
R1574:Parp4	UTSW	14	56602295	missense	probably damaging	0.98
R1574:Parp4	UTSW	14	56602295	missense	probably damaging	0.98
R1666:Parp4	UTSW	14	56624163	missense	possibly damaging	0.91
R1781:Parp4	UTSW	14	56627381	splice site	probably null
R1799:Parp4	UTSW	14	56648132	missense	unknown
R1823:Parp4	UTSW	14	56589872	splice site	probably benign
R1859:Parp4	UTSW	14	56648915	missense	unknown
R1919:Parp4	UTSW	14	56624017	missense	probably damaging	1.00
R2000:Parp4	UTSW	14	56613724	missense	probably damaging	0.98
R2032:Parp4	UTSW	14	56629096	missense	possibly damaging	0.71
R2034:Parp4	UTSW	14	56634263	missense	probably damaging	1.00
R2177:Parp4	UTSW	14	56659289	missense	unknown
R2291:Parp4	UTSW	14	56613817	missense	probably damaging	1.00
R2865:Parp4	UTSW	14	56613724	missense	probably damaging	0.98
R3012:Parp4	UTSW	14	56595416	critical splice donor site	probably null
R3841:Parp4	UTSW	14	56587778	missense	probably damaging	0.97
R3913:Parp4	UTSW	14	56620518	missense	probably damaging	1.00
R4064:Parp4	UTSW	14	56624140	missense	probably benign	0.06
R4201:Parp4	UTSW	14	56592391	missense	possibly damaging	0.95
R4288:Parp4	UTSW	14	56607494	missense	probably damaging	1.00
R4360:Parp4	UTSW	14	56629204	missense	possibly damaging	0.89
R4506:Parp4	UTSW	14	56652304	missense	unknown
R4577:Parp4	UTSW	14	56590410	missense	probably benign	0.33
R4633:Parp4	UTSW	14	56647591	missense	unknown
R4762:Parp4	UTSW	14	56610810	missense	probably damaging	1.00
R4836:Parp4	UTSW	14	56585738	missense	probably benign	0.00
R4974:Parp4	UTSW	14	56589898	missense	possibly damaging	0.92
R5049:Parp4	UTSW	14	56635731	missense	possibly damaging	0.81
R5479:Parp4	UTSW	14	56624095	missense	probably benign	0.01
R5683:Parp4	UTSW	14	56647429	nonsense	probably null
R5884:Parp4	UTSW	14	56614750	missense	probably damaging	1.00
R5965:Parp4	UTSW	14	56624032	missense	probably benign	0.11
R6001:Parp4	UTSW	14	56641283	missense	probably benign	0.01
R6027:Parp4	UTSW	14	56629158	missense	probably benign	0.28
R6230:Parp4	UTSW	14	56607533	missense	probably damaging	1.00
R6242:Parp4	UTSW	14	56595399	nonsense	probably null
R6355:Parp4	UTSW	14	56602300	missense	possibly damaging	0.61
R6414:Parp4	UTSW	14	56627381	splice site	probably null
R6418:Parp4	UTSW	14	56620651	critical splice donor site	probably null
R6477:Parp4	UTSW	14	56647237	missense	probably benign	0.00
R6542:Parp4	UTSW	14	56647882	missense	unknown
R6759:Parp4	UTSW	14	56620490	missense	probably benign	0.10
R6995:Parp4	UTSW	14	56613739	missense	probably damaging	0.97
R7002:Parp4	UTSW	14	56602404	missense	probably damaging	1.00
R7026:Parp4	UTSW	14	56620592	missense	probably benign	0.01
R7062:Parp4	UTSW	14	56614759	missense	possibly damaging	0.48
R7101:Parp4	UTSW	14	56589973	missense	probably benign	0.02
R7124:Parp4	UTSW	14	56602799	missense	probably benign	0.11
R7162:Parp4	UTSW	14	56648876	missense	unknown
R7293:Parp4	UTSW	14	56647846	small deletion	probably benign
R7297:Parp4	UTSW	14	56647681	missense	not run
R7337:Parp4	UTSW	14	56602395	missense	probably damaging	1.00
R7539:Parp4	UTSW	14	56635755	missense	probably damaging	1.00
R7575:Parp4	UTSW	14	56637918	missense	probably benign	0.28
R7808:Parp4	UTSW	14	56635748	missense	possibly damaging	0.65
R7854:Parp4	UTSW	14	56659348	missense	unknown
R7960:Parp4	UTSW	14	56595251	splice site	probably null
R8152:Parp4	UTSW	14	56647246	missense	probably benign	0.00
R8344:Parp4	UTSW	14	56648729	missense	unknown
R8416:Parp4	UTSW	14	56587814	critical splice donor site	probably null
R8726:Parp4	UTSW	14	56629099	missense	probably benign	0.04
R8752:Parp4	UTSW	14	56648616	missense	unknown
R8804:Parp4	UTSW	14	56616443	nonsense	probably null
R9046:Parp4	UTSW	14	56627470	missense	probably damaging	0.98
R9176:Parp4	UTSW	14	56635817	missense	possibly damaging	0.54
R9303:Parp4	UTSW	14	56595333	frame shift	probably null
R9303:Parp4	UTSW	14	56614767	critical splice donor site	probably null
R9305:Parp4	UTSW	14	56595333	frame shift	probably null
R9305:Parp4	UTSW	14	56614767	critical splice donor site	probably null
R9360:Parp4	UTSW	14	56641318	critical splice donor site	probably null
R9430:Parp4	UTSW	14	56629216	missense	probably damaging	1.00
R9491:Parp4	UTSW	14	56595371	missense	probably damaging	0.99
R9729:Parp4	UTSW	14	56648431	missense	unknown
RF020:Parp4	UTSW	14	56647349	missense	unknown
Z1177:Parp4	UTSW	14	56592367	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAACACCTTCATGACAGGATGTCGG -3'
(R):5'- AAATTGCTGGGTATGGGAGCAAAGTAT -3'

Sequencing Primer
(F):5'- CGGTATTCCCTGAACATCAGC -3'
(R):5'- caacacccaagaaacagagac -3'

Posted On

2014-04-24