Incidental Mutation 'R1649:Cramp1l'
ID174134
Institutional Source Beutler Lab
Gene Symbol Cramp1l
Ensembl Gene ENSMUSG00000038002
Gene Namecramped chromatin regulator homolog 1
Synonyms5830477H08Rik, Tce4
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1649 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24961228-25015230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24983243 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 422 (H422N)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: H422N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: H422N

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Cramp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1l APN 17 24983951 missense probably benign 0.11
IGL01360:Cramp1l APN 17 24997573 missense probably damaging 1.00
IGL01966:Cramp1l APN 17 24982943 missense probably benign 0.01
IGL02211:Cramp1l APN 17 24977636 missense possibly damaging 0.94
IGL02474:Cramp1l APN 17 24985050 missense probably damaging 0.98
IGL02798:Cramp1l APN 17 24968920 splice site probably benign
IGL03340:Cramp1l APN 17 24973542 missense probably damaging 1.00
R0106:Cramp1l UTSW 17 24972376 missense probably benign 0.30
R1054:Cramp1l UTSW 17 24983177 missense probably damaging 1.00
R1220:Cramp1l UTSW 17 24982237 missense probably damaging 1.00
R1341:Cramp1l UTSW 17 24977540 missense probably damaging 1.00
R1491:Cramp1l UTSW 17 24972349 missense probably benign 0.17
R1610:Cramp1l UTSW 17 24983951 missense probably benign 0.11
R1795:Cramp1l UTSW 17 24964910 missense probably damaging 1.00
R1856:Cramp1l UTSW 17 24968978 missense probably damaging 1.00
R1881:Cramp1l UTSW 17 24977682 splice site probably benign
R1968:Cramp1l UTSW 17 24964939 missense probably damaging 1.00
R2047:Cramp1l UTSW 17 25003215 nonsense probably null
R2099:Cramp1l UTSW 17 24973085 missense probably benign 0.01
R2298:Cramp1l UTSW 17 24997480 missense probably damaging 0.96
R3752:Cramp1l UTSW 17 24971558 missense probably damaging 1.00
R3821:Cramp1l UTSW 17 24974782 missense probably damaging 1.00
R3861:Cramp1l UTSW 17 24997614 splice site probably benign
R4399:Cramp1l UTSW 17 24979585 missense probably damaging 1.00
R4847:Cramp1l UTSW 17 24985089 missense probably damaging 1.00
R4883:Cramp1l UTSW 17 24982319 missense probably benign
R5579:Cramp1l UTSW 17 24973113 missense possibly damaging 0.89
R5631:Cramp1l UTSW 17 24985603 missense possibly damaging 0.93
R5716:Cramp1l UTSW 17 24974735 missense probably damaging 0.99
R6589:Cramp1l UTSW 17 24977492 splice site probably null
R6631:Cramp1l UTSW 17 24983957 missense probably benign 0.40
R7307:Cramp1l UTSW 17 24974745 missense possibly damaging 0.94
R7323:Cramp1l UTSW 17 24982405 missense possibly damaging 0.90
R7672:Cramp1l UTSW 17 24982466 missense probably damaging 0.96
R7832:Cramp1l UTSW 17 24983222 missense probably damaging 0.96
R8071:Cramp1l UTSW 17 24982700 missense probably damaging 0.99
R8244:Cramp1l UTSW 17 24971410 missense probably damaging 1.00
R8430:Cramp1l UTSW 17 24977562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAAGGTGTGGTCCAGAGTCC -3'
(R):5'- GAAGACCCTAATCGGCATCCATAGC -3'

Sequencing Primer
(F):5'- AGCACTCTCAGGGGAACTTTC -3'
(R):5'- CTTCACTGAGGAGCACTGTG -3'
Posted On2014-04-24