Incidental Mutation 'R1649:Olfr127'
ID174136
Institutional Source Beutler Lab
Gene Symbol Olfr127
Ensembl Gene ENSMUSG00000058114
Gene Nameolfactory receptor 127
SynonymsMOR218-7, GA_x6K02T2PSCP-2354126-2355093
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1649 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37900437-37906795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37904169 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 208 (F208L)
Ref Sequence ENSEMBL: ENSMUSP00000149133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076331] [ENSMUST00000217223]
Predicted Effect probably benign
Transcript: ENSMUST00000076331
AA Change: F208L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075669
Gene: ENSMUSG00000058114
AA Change: F208L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.7e-46 PFAM
Pfam:7tm_1 41 290 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217223
AA Change: F208L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Olfr127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr127 APN 17 37904257 missense probably damaging 0.98
IGL00981:Olfr127 APN 17 37904181 missense probably benign 0.03
IGL02271:Olfr127 APN 17 37904243 missense probably benign 0.22
IGL02409:Olfr127 APN 17 37903788 missense probably damaging 0.99
R1808:Olfr127 UTSW 17 37903770 missense probably damaging 1.00
R2360:Olfr127 UTSW 17 37904454 missense possibly damaging 0.94
R3808:Olfr127 UTSW 17 37903573 missense probably benign 0.00
R3809:Olfr127 UTSW 17 37903573 missense probably benign 0.00
R3953:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R3955:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R3957:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R4683:Olfr127 UTSW 17 37904148 missense probably benign
R5430:Olfr127 UTSW 17 37904413 missense probably damaging 1.00
R5716:Olfr127 UTSW 17 37903828 missense probably benign 0.00
R5866:Olfr127 UTSW 17 37903809 nonsense probably null
R7074:Olfr127 UTSW 17 37903827 missense possibly damaging 0.80
R7238:Olfr127 UTSW 17 37904437 missense probably benign 0.37
R8098:Olfr127 UTSW 17 37904359 missense probably damaging 1.00
R8212:Olfr127 UTSW 17 37904257 missense probably benign 0.00
X0021:Olfr127 UTSW 17 37903756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACAGTTCCCTGGCACGAAG -3'
(R):5'- TTTCATGTCCAGTCTTAGCAGGCAC -3'

Sequencing Primer
(F):5'- GCACTATGAGGTCATAATGAGTCCC -3'
(R):5'- GTCTTAGCAGGCACTAAAAACAG -3'
Posted On2014-04-24