Incidental Mutation 'R1649:Jcad'
ID174137
Institutional Source Beutler Lab
Gene Symbol Jcad
Ensembl Gene ENSMUSG00000033960
Gene Namejunctional cadherin 5 associated
Synonyms9430020K01Rik
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1649 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location4634929-4682868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4673309 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 357 (P357Q)
Ref Sequence ENSEMBL: ENSMUSP00000038613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037029]
Predicted Effect probably damaging
Transcript: ENSMUST00000037029
AA Change: P357Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038613
Gene: ENSMUSG00000033960
AA Change: P357Q

DomainStartEndE-ValueType
Pfam:JCAD 1 1309 N/A PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Jcad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Jcad APN 18 4675692 missense probably benign 0.14
IGL00672:Jcad APN 18 4674835 missense possibly damaging 0.77
IGL00782:Jcad APN 18 4675073 missense probably benign 0.00
IGL00825:Jcad APN 18 4673516 missense probably damaging 1.00
IGL01522:Jcad APN 18 4673312 missense probably damaging 0.97
IGL01796:Jcad APN 18 4672855 nonsense probably null
IGL01973:Jcad APN 18 4675514 missense probably benign 0.21
IGL02083:Jcad APN 18 4680266 utr 3 prime probably benign
IGL02625:Jcad APN 18 4674422 missense probably benign 0.03
IGL03002:Jcad APN 18 4675153 missense probably benign 0.00
IGL03325:Jcad APN 18 4673902 missense probably benign
R0304:Jcad UTSW 18 4673325 missense possibly damaging 0.75
R0487:Jcad UTSW 18 4673243 missense probably damaging 1.00
R0519:Jcad UTSW 18 4649122 start gained probably benign
R0664:Jcad UTSW 18 4676063 missense probably damaging 0.97
R1710:Jcad UTSW 18 4674511 missense probably damaging 1.00
R1734:Jcad UTSW 18 4674526 missense probably damaging 1.00
R1823:Jcad UTSW 18 4675780 missense probably damaging 1.00
R1824:Jcad UTSW 18 4649293 missense probably benign
R1850:Jcad UTSW 18 4675730 missense possibly damaging 0.95
R1872:Jcad UTSW 18 4673048 missense probably benign
R1878:Jcad UTSW 18 4673857 missense possibly damaging 0.60
R1918:Jcad UTSW 18 4674292 missense probably damaging 1.00
R1967:Jcad UTSW 18 4675162 missense probably benign 0.07
R2420:Jcad UTSW 18 4675952 missense probably damaging 1.00
R2504:Jcad UTSW 18 4674026 missense probably damaging 0.99
R2936:Jcad UTSW 18 4675153 missense probably benign 0.00
R4420:Jcad UTSW 18 4676032 missense probably benign 0.00
R4668:Jcad UTSW 18 4680221 splice site probably null
R4670:Jcad UTSW 18 4674175 missense probably benign 0.03
R4671:Jcad UTSW 18 4674175 missense probably benign 0.03
R4707:Jcad UTSW 18 4649338 nonsense probably null
R4720:Jcad UTSW 18 4674055 missense probably benign 0.03
R4815:Jcad UTSW 18 4675223 missense possibly damaging 0.94
R4906:Jcad UTSW 18 4673762 missense probably damaging 1.00
R5214:Jcad UTSW 18 4674134 missense probably damaging 1.00
R5439:Jcad UTSW 18 4675790 missense probably damaging 1.00
R5563:Jcad UTSW 18 4673944 missense possibly damaging 0.93
R5721:Jcad UTSW 18 4676044 missense possibly damaging 0.48
R5825:Jcad UTSW 18 4674896 missense probably benign 0.00
R5952:Jcad UTSW 18 4674554 missense probably damaging 1.00
R6661:Jcad UTSW 18 4675256 missense probably damaging 1.00
R6928:Jcad UTSW 18 4673372 missense probably benign 0.00
R7426:Jcad UTSW 18 4675529 missense probably benign 0.11
R7808:Jcad UTSW 18 4673113 missense probably damaging 1.00
R7943:Jcad UTSW 18 4672700 missense probably damaging 1.00
R8010:Jcad UTSW 18 4674581 missense probably benign
R8080:Jcad UTSW 18 4649270 missense probably benign 0.01
R8133:Jcad UTSW 18 4649384 missense probably benign 0.03
R8408:Jcad UTSW 18 4649402 missense possibly damaging 0.55
T0722:Jcad UTSW 18 4675531 missense probably benign 0.25
X0017:Jcad UTSW 18 4676044 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGATTTCAGGACCACCAGCACAG -3'
(R):5'- TACCGAAGGGGCATCATCGTACTG -3'

Sequencing Primer
(F):5'- CAGCACAGGGACCCACG -3'
(R):5'- TGGAATGTACTGAATAGAACCCC -3'
Posted On2014-04-24