Incidental Mutation 'R1650:Pgm2'
Institutional Source Beutler Lab
Gene Symbol Pgm2
Ensembl Gene ENSMUSG00000025791
Gene Namephosphoglucomutase 2
Synonyms2610020G18Rik, Pgm-2
MMRRC Submission 039686-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R1650 (G1)
Quality Score214
Status Validated
Chromosomal Location99929414-99987294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99962070 bp
Amino Acid Change Lysine to Glutamic Acid at position 146 (K146E)
Ref Sequence ENSEMBL: ENSMUSP00000061227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058351] [ENSMUST00000102783]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058351
AA Change: K146E

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000061227
Gene: ENSMUSG00000025791
AA Change: K146E

Pfam:PGM_PMM_I 14 158 1.7e-42 PFAM
Pfam:PGM_PMM_II 193 301 3.3e-20 PFAM
Pfam:PGM_PMM_III 306 420 1.1e-33 PFAM
Pfam:PGM_PMM_IV 436 543 1.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102783
AA Change: K164E

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099844
Gene: ENSMUSG00000025791
AA Change: K164E

Pfam:PGM_PMM_I 32 176 2.3e-37 PFAM
Pfam:PGM_PMM_II 211 319 1.2e-19 PFAM
Pfam:PGM_PMM_III 324 438 3.7e-33 PFAM
Pfam:PGM_PMM_IV 455 561 3.6e-8 PFAM
Meta Mutation Damage Score 0.1210 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.0%
  • 20x: 83.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T G 2: 103,702,402 V515G probably damaging Het
Arl5a A T 2: 52,412,105 I99N probably damaging Het
Atp8b1 A G 18: 64,571,549 probably benign Het
Bag4 T A 8: 25,777,424 Q126L probably damaging Het
Ccser1 A G 6: 61,638,490 T659A probably benign Het
Cenpn A G 8: 116,934,759 D199G probably damaging Het
Cfhr3 A G 1: 139,593,826 noncoding transcript Het
Clca2 T A 3: 145,092,212 H164L probably damaging Het
Col5a1 C A 2: 27,922,159 S84R unknown Het
Ctsc T A 7: 88,281,426 L71* probably null Het
Cyp2c70 A G 19: 40,165,477 Y223H probably benign Het
Dbt A G 3: 116,534,732 probably null Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dll4 T C 2: 119,331,130 S398P probably damaging Het
Dyrk4 T C 6: 126,899,829 K62E probably benign Het
Fam35a T A 14: 34,259,617 probably benign Het
Fgf22 A T 10: 79,755,189 Y24F probably damaging Het
Ggt5 A G 10: 75,604,761 R239G probably benign Het
Gm11360 C T 13: 27,956,396 A81V unknown Het
Htr5b T A 1: 121,528,162 T10S probably benign Het
Igsf10 T C 3: 59,326,162 R1717G probably damaging Het
Itsn2 T A 12: 4,637,767 V556D probably damaging Het
Kdm3b T C 18: 34,809,115 V553A possibly damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lca5l T C 16: 96,178,940 probably null Het
Lmbrd1 T C 1: 24,711,558 W171R probably damaging Het
Lrp6 T C 6: 134,468,769 Y1027C probably benign Het
Macf1 A T 4: 123,456,600 Y1702* probably null Het
Mon2 T C 10: 122,995,777 I1675V probably benign Het
Mtcl1 T A 17: 66,385,876 K486M probably damaging Het
Nek1 A T 8: 61,036,076 H338L probably benign Het
Ola1 A T 2: 73,156,894 D131E possibly damaging Het
Olfr1128 C A 2: 87,545,428 V39L probably benign Het
Olfr1158 C T 2: 87,990,801 A230V probably benign Het
Olfr1280 C T 2: 111,316,295 A272V probably benign Het
Olfr1366 T C 13: 21,537,079 N294D probably damaging Het
Olfr141 A T 2: 86,806,747 M84K possibly damaging Het
Olfr845 T G 9: 19,338,647 F62L possibly damaging Het
Olr1 T A 6: 129,507,089 M7L probably benign Het
Pan2 G A 10: 128,317,899 E980K probably damaging Het
Phlpp2 T C 8: 109,933,955 probably benign Het
Plekhs1 G T 19: 56,471,042 G75C probably damaging Het
Plin4 G A 17: 56,104,931 T700I probably damaging Het
Podxl2 G A 6: 88,849,919 P71L probably benign Het
Pot1a A T 6: 25,745,965 V579D probably damaging Het
Poteg A G 8: 27,463,785 D318G probably benign Het
Ppp4r3a A T 12: 101,044,619 D554E probably damaging Het
Proser3 G A 7: 30,540,326 A451V probably damaging Het
Rnf165 A C 18: 77,462,417 probably null Het
Strc T C 2: 121,380,885 probably benign Het
Syce1 C A 7: 140,778,387 C216F possibly damaging Het
Syne2 A T 12: 75,904,259 K395* probably null Het
Trim28 G A 7: 13,030,849 G831D possibly damaging Het
Tyw1 A G 5: 130,288,911 I434V possibly damaging Het
Ubox5 G A 2: 130,600,425 A114V probably benign Het
Ubqln3 C T 7: 104,141,021 V621I possibly damaging Het
Unc79 A G 12: 103,112,793 D1543G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Wrnip1 C A 13: 32,805,379 H283Q probably benign Het
Zan A T 5: 137,394,601 probably benign Het
Zcchc10 A T 11: 53,327,402 K1* probably null Het
Zfp592 T A 7: 81,038,100 S925T probably benign Het
Other mutations in Pgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Pgm2 APN 4 99929606 missense probably damaging 1.00
IGL01468:Pgm2 APN 4 99962170 missense possibly damaging 0.82
IGL02013:Pgm2 APN 4 99983961 splice site probably benign
IGL02237:Pgm2 APN 4 99963510 splice site probably benign
IGL02945:Pgm2 APN 4 99961534 missense probably benign
IGL03201:Pgm2 APN 4 99970039 missense probably damaging 0.99
IGL03373:Pgm2 APN 4 99961544 missense probably damaging 1.00
R0349:Pgm2 UTSW 4 99963617 missense probably damaging 1.00
R0683:Pgm2 UTSW 4 99961543 missense probably damaging 0.99
R1650:Pgm2 UTSW 4 99962079 missense probably benign 0.28
R1741:Pgm2 UTSW 4 99964865 splice site probably null
R1759:Pgm2 UTSW 4 99967108 missense probably damaging 1.00
R1843:Pgm2 UTSW 4 99961478 missense probably damaging 1.00
R3111:Pgm2 UTSW 4 99956025 missense probably benign
R4115:Pgm2 UTSW 4 99962151 nonsense probably null
R4426:Pgm2 UTSW 4 99962140 missense probably benign 0.04
R4748:Pgm2 UTSW 4 99981979 missense probably benign 0.24
R4910:Pgm2 UTSW 4 99963527 missense probably damaging 1.00
R4920:Pgm2 UTSW 4 99986733 missense probably damaging 1.00
R5289:Pgm2 UTSW 4 99967069 missense probably damaging 1.00
R5764:Pgm2 UTSW 4 99964846 missense probably damaging 1.00
R6199:Pgm2 UTSW 4 99978954 missense probably damaging 1.00
R6311:Pgm2 UTSW 4 99970040 missense possibly damaging 0.93
R6600:Pgm2 UTSW 4 99967062 nonsense probably null
R6818:Pgm2 UTSW 4 99963566 missense probably damaging 1.00
R6892:Pgm2 UTSW 4 99929708 missense probably benign
R6984:Pgm2 UTSW 4 99929654 missense probably benign 0.04
R7429:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R7430:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R8017:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8019:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8143:Pgm2 UTSW 4 99967218 splice site probably null
R8724:Pgm2 UTSW 4 99929767 missense probably benign 0.00
R8893:Pgm2 UTSW 4 99967100 missense probably damaging 0.99
RF018:Pgm2 UTSW 4 99962303 splice site probably null
Z1176:Pgm2 UTSW 4 99978997 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agtgagaatttgactcagaaacatc -3'
Posted On2014-04-24