Incidental Mutation 'R1650:Pot1a'
ID 174172
Institutional Source Beutler Lab
Gene Symbol Pot1a
Ensembl Gene ENSMUSG00000029676
Gene Name protection of telomeres 1A
Synonyms 1500031H18Rik, Pot1
MMRRC Submission 039686-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1650 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 25743737-25809246 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25745965 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 579 (V579D)
Ref Sequence ENSEMBL: ENSMUSP00000131928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115330] [ENSMUST00000166445]
AlphaFold Q91WC1
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115329
SMART Domains Protein: ENSMUSP00000110984
Gene: ENSMUSG00000029676

Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115330
AA Change: V579D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676
AA Change: V579D

Telo_bind 11 141 3.6e-53 SMART
Pfam:POT1PC 152 299 6.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134339
Predicted Effect probably damaging
Transcript: ENSMUST00000166445
AA Change: V579D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676
AA Change: V579D

Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Meta Mutation Damage Score 0.8037 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.0%
  • 20x: 83.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T G 2: 103,702,402 V515G probably damaging Het
Arl5a A T 2: 52,412,105 I99N probably damaging Het
Atp8b1 A G 18: 64,571,549 probably benign Het
Bag4 T A 8: 25,777,424 Q126L probably damaging Het
Ccser1 A G 6: 61,638,490 T659A probably benign Het
Cenpn A G 8: 116,934,759 D199G probably damaging Het
Cfhr3 A G 1: 139,593,826 noncoding transcript Het
Clca2 T A 3: 145,092,212 H164L probably damaging Het
Col5a1 C A 2: 27,922,159 S84R unknown Het
Ctsc T A 7: 88,281,426 L71* probably null Het
Cyp2c70 A G 19: 40,165,477 Y223H probably benign Het
Dbt A G 3: 116,534,732 probably null Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dll4 T C 2: 119,331,130 S398P probably damaging Het
Dyrk4 T C 6: 126,899,829 K62E probably benign Het
Fam35a T A 14: 34,259,617 probably benign Het
Fgf22 A T 10: 79,755,189 Y24F probably damaging Het
Ggt5 A G 10: 75,604,761 R239G probably benign Het
Gm11360 C T 13: 27,956,396 A81V unknown Het
Htr5b T A 1: 121,528,162 T10S probably benign Het
Igsf10 T C 3: 59,326,162 R1717G probably damaging Het
Itsn2 T A 12: 4,637,767 V556D probably damaging Het
Kdm3b T C 18: 34,809,115 V553A possibly damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lca5l T C 16: 96,178,940 probably null Het
Lmbrd1 T C 1: 24,711,558 W171R probably damaging Het
Lrp6 T C 6: 134,468,769 Y1027C probably benign Het
Macf1 A T 4: 123,456,600 Y1702* probably null Het
Mon2 T C 10: 122,995,777 I1675V probably benign Het
Mtcl1 T A 17: 66,385,876 K486M probably damaging Het
Nek1 A T 8: 61,036,076 H338L probably benign Het
Ola1 A T 2: 73,156,894 D131E possibly damaging Het
Olfr1128 C A 2: 87,545,428 V39L probably benign Het
Olfr1158 C T 2: 87,990,801 A230V probably benign Het
Olfr1280 C T 2: 111,316,295 A272V probably benign Het
Olfr1366 T C 13: 21,537,079 N294D probably damaging Het
Olfr141 A T 2: 86,806,747 M84K possibly damaging Het
Olfr845 T G 9: 19,338,647 F62L possibly damaging Het
Olr1 T A 6: 129,507,089 M7L probably benign Het
Pan2 G A 10: 128,317,899 E980K probably damaging Het
Pgm2 A G 4: 99,962,070 K146E possibly damaging Het
Pgm2 C A 4: 99,962,079 Q149K probably benign Het
Phlpp2 T C 8: 109,933,955 probably benign Het
Plekhs1 G T 19: 56,471,042 G75C probably damaging Het
Plin4 G A 17: 56,104,931 T700I probably damaging Het
Podxl2 G A 6: 88,849,919 P71L probably benign Het
Poteg A G 8: 27,463,785 D318G probably benign Het
Ppp4r3a A T 12: 101,044,619 D554E probably damaging Het
Proser3 G A 7: 30,540,326 A451V probably damaging Het
Rnf165 A C 18: 77,462,417 probably null Het
Strc T C 2: 121,380,885 probably benign Het
Syce1 C A 7: 140,778,387 C216F possibly damaging Het
Syne2 A T 12: 75,904,259 K395* probably null Het
Trim28 G A 7: 13,030,849 G831D possibly damaging Het
Tyw1 A G 5: 130,288,911 I434V possibly damaging Het
Ubox5 G A 2: 130,600,425 A114V probably benign Het
Ubqln3 C T 7: 104,141,021 V621I possibly damaging Het
Unc79 A G 12: 103,112,793 D1543G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Wrnip1 C A 13: 32,805,379 H283Q probably benign Het
Zan A T 5: 137,394,601 probably benign Het
Zcchc10 A T 11: 53,327,402 K1* probably null Het
Zfp592 T A 7: 81,038,100 S925T probably benign Het
Other mutations in Pot1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Pot1a APN 6 25744628 missense probably benign 0.01
IGL01393:Pot1a APN 6 25744631 nonsense probably null
IGL01411:Pot1a APN 6 25750144 splice site probably benign
IGL01774:Pot1a APN 6 25753277 missense probably benign 0.00
IGL01981:Pot1a APN 6 25750100 missense probably damaging 1.00
IGL02404:Pot1a APN 6 25764432 splice site probably benign
IGL02530:Pot1a APN 6 25794593 missense probably damaging 1.00
IGL02755:Pot1a APN 6 25771613 missense possibly damaging 0.81
IGL03127:Pot1a APN 6 25794616 missense probably benign 0.00
IGL03396:Pot1a APN 6 25745914 missense possibly damaging 0.93
BB001:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
BB011:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R0329:Pot1a UTSW 6 25778831 splice site probably benign
R0359:Pot1a UTSW 6 25771680 splice site probably benign
R0530:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R0840:Pot1a UTSW 6 25748284 splice site probably benign
R0918:Pot1a UTSW 6 25756268 missense possibly damaging 0.92
R1937:Pot1a UTSW 6 25753324 missense probably benign 0.15
R2142:Pot1a UTSW 6 25750044 splice site probably null
R4072:Pot1a UTSW 6 25752357 splice site probably null
R4074:Pot1a UTSW 6 25752357 splice site probably null
R4322:Pot1a UTSW 6 25745930 missense probably benign 0.02
R4895:Pot1a UTSW 6 25753206 missense probably damaging 1.00
R4910:Pot1a UTSW 6 25746021 intron probably benign
R4933:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R5530:Pot1a UTSW 6 25778894 missense probably damaging 1.00
R5748:Pot1a UTSW 6 25758856 missense possibly damaging 0.77
R5775:Pot1a UTSW 6 25757298 splice site probably null
R5870:Pot1a UTSW 6 25778951 missense possibly damaging 0.90
R6180:Pot1a UTSW 6 25771621 missense probably benign 0.00
R6377:Pot1a UTSW 6 25778870 missense probably benign 0.06
R7251:Pot1a UTSW 6 25752498 splice site probably null
R7457:Pot1a UTSW 6 25771622 missense probably benign 0.26
R7679:Pot1a UTSW 6 25771634 missense probably benign 0.16
R7717:Pot1a UTSW 6 25758823 missense probably benign 0.45
R7924:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R8078:Pot1a UTSW 6 25750108 missense probably benign 0.13
R8084:Pot1a UTSW 6 25771536 missense possibly damaging 0.81
R8170:Pot1a UTSW 6 25758803 makesense probably null
R9070:Pot1a UTSW 6 25744630 missense
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gagagagagagagagagagagag -3'
(R):5'- tggaggtcagaagaggatatgag -3'
Posted On 2014-04-24