Incidental Mutation 'R1650:Dyrk4'
ID174174
Institutional Source Beutler Lab
Gene Symbol Dyrk4
Ensembl Gene ENSMUSG00000030345
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
SynonymsDyrk4a, Dyrk4b
MMRRC Submission 039686-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1650 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126876020-126921839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126899829 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 62 (K62E)
Ref Sequence ENSEMBL: ENSMUSP00000077606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078521]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032495
Predicted Effect probably benign
Transcript: ENSMUST00000078521
AA Change: K62E

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077606
Gene: ENSMUSG00000030345
AA Change: K62E

DomainStartEndE-ValueType
S_TKc 219 515 2.9e-84 SMART
low complexity region 555 573 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.0%
  • 20x: 83.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to a conserved family of serine/threonine protein kinases. Members of this dual specificity kinase family are thought to function in the regulation of cell differentiation and proliferation, survival, and in development. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]
PHENOTYPE: Contrary to expectation, homozygous null males are fertile and do not exhibit any obvious dysfunction in spermatogenesis, sperm motility and fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T G 2: 103,702,402 V515G probably damaging Het
Arl5a A T 2: 52,412,105 I99N probably damaging Het
Atp8b1 A G 18: 64,571,549 probably benign Het
Bag4 T A 8: 25,777,424 Q126L probably damaging Het
Ccser1 A G 6: 61,638,490 T659A probably benign Het
Cenpn A G 8: 116,934,759 D199G probably damaging Het
Cfhr3 A G 1: 139,593,826 noncoding transcript Het
Clca2 T A 3: 145,092,212 H164L probably damaging Het
Col5a1 C A 2: 27,922,159 S84R unknown Het
Ctsc T A 7: 88,281,426 L71* probably null Het
Cyp2c70 A G 19: 40,165,477 Y223H probably benign Het
Dbt A G 3: 116,534,732 probably null Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dll4 T C 2: 119,331,130 S398P probably damaging Het
Fam35a T A 14: 34,259,617 probably benign Het
Fgf22 A T 10: 79,755,189 Y24F probably damaging Het
Ggt5 A G 10: 75,604,761 R239G probably benign Het
Gm11360 C T 13: 27,956,396 A81V unknown Het
Htr5b T A 1: 121,528,162 T10S probably benign Het
Igsf10 T C 3: 59,326,162 R1717G probably damaging Het
Itsn2 T A 12: 4,637,767 V556D probably damaging Het
Kdm3b T C 18: 34,809,115 V553A possibly damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lca5l T C 16: 96,178,940 probably null Het
Lmbrd1 T C 1: 24,711,558 W171R probably damaging Het
Lrp6 T C 6: 134,468,769 Y1027C probably benign Het
Macf1 A T 4: 123,456,600 Y1702* probably null Het
Mon2 T C 10: 122,995,777 I1675V probably benign Het
Mtcl1 T A 17: 66,385,876 K486M probably damaging Het
Nek1 A T 8: 61,036,076 H338L probably benign Het
Ola1 A T 2: 73,156,894 D131E possibly damaging Het
Olfr1128 C A 2: 87,545,428 V39L probably benign Het
Olfr1158 C T 2: 87,990,801 A230V probably benign Het
Olfr1280 C T 2: 111,316,295 A272V probably benign Het
Olfr1366 T C 13: 21,537,079 N294D probably damaging Het
Olfr141 A T 2: 86,806,747 M84K possibly damaging Het
Olfr845 T G 9: 19,338,647 F62L possibly damaging Het
Olr1 T A 6: 129,507,089 M7L probably benign Het
Pan2 G A 10: 128,317,899 E980K probably damaging Het
Pgm2 A G 4: 99,962,070 K146E possibly damaging Het
Pgm2 C A 4: 99,962,079 Q149K probably benign Het
Phlpp2 T C 8: 109,933,955 probably benign Het
Plekhs1 G T 19: 56,471,042 G75C probably damaging Het
Plin4 G A 17: 56,104,931 T700I probably damaging Het
Podxl2 G A 6: 88,849,919 P71L probably benign Het
Pot1a A T 6: 25,745,965 V579D probably damaging Het
Poteg A G 8: 27,463,785 D318G probably benign Het
Ppp4r3a A T 12: 101,044,619 D554E probably damaging Het
Proser3 G A 7: 30,540,326 A451V probably damaging Het
Rnf165 A C 18: 77,462,417 probably null Het
Strc T C 2: 121,380,885 probably benign Het
Syce1 C A 7: 140,778,387 C216F possibly damaging Het
Syne2 A T 12: 75,904,259 K395* probably null Het
Trim28 G A 7: 13,030,849 G831D possibly damaging Het
Tyw1 A G 5: 130,288,911 I434V possibly damaging Het
Ubox5 G A 2: 130,600,425 A114V probably benign Het
Ubqln3 C T 7: 104,141,021 V621I possibly damaging Het
Unc79 A G 12: 103,112,793 D1543G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Wrnip1 C A 13: 32,805,379 H283Q probably benign Het
Zan A T 5: 137,394,601 probably benign Het
Zcchc10 A T 11: 53,327,402 K1* probably null Het
Zfp592 T A 7: 81,038,100 S925T probably benign Het
Other mutations in Dyrk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02474:Dyrk4 APN 6 126880231 missense probably damaging 1.00
IGL02598:Dyrk4 APN 6 126884019 intron probably benign
IGL02697:Dyrk4 APN 6 126899008 missense possibly damaging 0.88
IGL03127:Dyrk4 APN 6 126897171 missense possibly damaging 0.92
IGL03229:Dyrk4 APN 6 126886642 unclassified probably benign
IGL03248:Dyrk4 APN 6 126884053 missense probably benign 0.05
R0597:Dyrk4 UTSW 6 126886649 splice site probably null
R0862:Dyrk4 UTSW 6 126877333 missense possibly damaging 0.78
R0864:Dyrk4 UTSW 6 126877333 missense possibly damaging 0.78
R1470:Dyrk4 UTSW 6 126916374 nonsense probably null
R1470:Dyrk4 UTSW 6 126916374 nonsense probably null
R1645:Dyrk4 UTSW 6 126894793 nonsense probably null
R1885:Dyrk4 UTSW 6 126877181 missense probably benign 0.15
R3947:Dyrk4 UTSW 6 126885305 missense probably damaging 1.00
R3948:Dyrk4 UTSW 6 126885305 missense probably damaging 1.00
R3949:Dyrk4 UTSW 6 126885305 missense probably damaging 1.00
R4794:Dyrk4 UTSW 6 126885337 missense possibly damaging 0.79
R5991:Dyrk4 UTSW 6 126880225 missense probably benign 0.44
R6143:Dyrk4 UTSW 6 126886651 critical splice donor site probably null
R6269:Dyrk4 UTSW 6 126886727 missense probably damaging 1.00
R6572:Dyrk4 UTSW 6 126897238 missense probably benign
R6598:Dyrk4 UTSW 6 126876326 missense probably benign 0.20
R6703:Dyrk4 UTSW 6 126890082 missense probably damaging 1.00
R6750:Dyrk4 UTSW 6 126898955 missense probably benign 0.00
R7214:Dyrk4 UTSW 6 126885237 missense probably benign 0.35
R7585:Dyrk4 UTSW 6 126890044 missense probably damaging 1.00
R8101:Dyrk4 UTSW 6 126891649 missense possibly damaging 0.87
R8203:Dyrk4 UTSW 6 126894834 missense probably damaging 1.00
R8769:Dyrk4 UTSW 6 126880245 missense possibly damaging 0.49
Z1176:Dyrk4 UTSW 6 126892128 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTGAAAATGTGGAGAAGTTCCTC -3'
(R):5'- TGACCCAGAACTCCTGTCTCAGTTATC -3'

Sequencing Primer
(F):5'- AGAAGTTCCTCCATATTCCTGAACG -3'
(R):5'- cattcatacattcaccgagcac -3'
Posted On2014-04-24