Mutagenetix > Incidental Mutation

Incidental Mutation 'R1650:Ubqln3'

174183

Institutional Source

Beutler Lab

Gene Symbol

Ubqln3

Ensembl Gene

ENSMUSG00000051618

Gene Name

ubiquilin 3

Synonyms

4933400K24Rik

MMRRC Submission

039686-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R1650 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104140623-104143279 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 104141021 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 621 (V621I)

Ref Sequence

ENSEMBL: ENSMUSP00000055229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]

AlphaFold

Q8C5U9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057254
AA Change: V621I

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: V621I

Domain	Start	End	E-Value	Type
UBQ	22	92	1.56e-15	SMART
low complexity region	103	115	N/A	INTRINSIC
low complexity region	120	151	N/A	INTRINSIC
STI1	194	233	4.25e-7	SMART
low complexity region	280	291	N/A	INTRINSIC
low complexity region	313	328	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
UBA	619	657	4.22e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138055

SMART Domains

Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.7%
3x: 97.4%
10x: 93.0%
20x: 83.4%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	T	G	2: 103,702,402	V515G	probably damaging	Het
Arl5a	A	T	2: 52,412,105	I99N	probably damaging	Het
Atp8b1	A	G	18: 64,571,549		probably benign	Het
Bag4	T	A	8: 25,777,424	Q126L	probably damaging	Het
Ccser1	A	G	6: 61,638,490	T659A	probably benign	Het
Cenpn	A	G	8: 116,934,759	D199G	probably damaging	Het
Cfhr3	A	G	1: 139,593,826		noncoding transcript	Het
Clca2	T	A	3: 145,092,212	H164L	probably damaging	Het
Col5a1	C	A	2: 27,922,159	S84R	unknown	Het
Ctsc	T	A	7: 88,281,426	L71*	probably null	Het
Cyp2c70	A	G	19: 40,165,477	Y223H	probably benign	Het
Dbt	A	G	3: 116,534,732		probably null	Het
Dlg2	T	C	7: 92,431,051	V614A	probably damaging	Het
Dll4	T	C	2: 119,331,130	S398P	probably damaging	Het
Dyrk4	T	C	6: 126,899,829	K62E	probably benign	Het
Fam35a	T	A	14: 34,259,617		probably benign	Het
Fgf22	A	T	10: 79,755,189	Y24F	probably damaging	Het
Ggt5	A	G	10: 75,604,761	R239G	probably benign	Het
Gm11360	C	T	13: 27,956,396	A81V	unknown	Het
Htr5b	T	A	1: 121,528,162	T10S	probably benign	Het
Igsf10	T	C	3: 59,326,162	R1717G	probably damaging	Het
Itsn2	T	A	12: 4,637,767	V556D	probably damaging	Het
Kdm3b	T	C	18: 34,809,115	V553A	possibly damaging	Het
Krt84	G	A	15: 101,525,963	S523F	possibly damaging	Het
Lca5l	T	C	16: 96,178,940		probably null	Het
Lmbrd1	T	C	1: 24,711,558	W171R	probably damaging	Het
Lrp6	T	C	6: 134,468,769	Y1027C	probably benign	Het
Macf1	A	T	4: 123,456,600	Y1702*	probably null	Het
Mon2	T	C	10: 122,995,777	I1675V	probably benign	Het
Mtcl1	T	A	17: 66,385,876	K486M	probably damaging	Het
Nek1	A	T	8: 61,036,076	H338L	probably benign	Het
Ola1	A	T	2: 73,156,894	D131E	possibly damaging	Het
Olfr1128	C	A	2: 87,545,428	V39L	probably benign	Het
Olfr1158	C	T	2: 87,990,801	A230V	probably benign	Het
Olfr1280	C	T	2: 111,316,295	A272V	probably benign	Het
Olfr1366	T	C	13: 21,537,079	N294D	probably damaging	Het
Olfr141	A	T	2: 86,806,747	M84K	possibly damaging	Het
Olfr845	T	G	9: 19,338,647	F62L	possibly damaging	Het
Olr1	T	A	6: 129,507,089	M7L	probably benign	Het
Pan2	G	A	10: 128,317,899	E980K	probably damaging	Het
Pgm2	A	G	4: 99,962,070	K146E	possibly damaging	Het
Pgm2	C	A	4: 99,962,079	Q149K	probably benign	Het
Phlpp2	T	C	8: 109,933,955		probably benign	Het
Plekhs1	G	T	19: 56,471,042	G75C	probably damaging	Het
Plin4	G	A	17: 56,104,931	T700I	probably damaging	Het
Podxl2	G	A	6: 88,849,919	P71L	probably benign	Het
Pot1a	A	T	6: 25,745,965	V579D	probably damaging	Het
Poteg	A	G	8: 27,463,785	D318G	probably benign	Het
Ppp4r3a	A	T	12: 101,044,619	D554E	probably damaging	Het
Proser3	G	A	7: 30,540,326	A451V	probably damaging	Het
Rnf165	A	C	18: 77,462,417		probably null	Het
Strc	T	C	2: 121,380,885		probably benign	Het
Syce1	C	A	7: 140,778,387	C216F	possibly damaging	Het
Syne2	A	T	12: 75,904,259	K395*	probably null	Het
Trim28	G	A	7: 13,030,849	G831D	possibly damaging	Het
Tyw1	A	G	5: 130,288,911	I434V	possibly damaging	Het
Ubox5	G	A	2: 130,600,425	A114V	probably benign	Het
Unc79	A	G	12: 103,112,793	D1543G	possibly damaging	Het
Vmn2r115	ATCTTCT	ATCT	17: 23,359,988		probably benign	Het
Wrnip1	C	A	13: 32,805,379	H283Q	probably benign	Het
Zan	A	T	5: 137,394,601		probably benign	Het
Zcchc10	A	T	11: 53,327,402	K1*	probably null	Het
Zfp592	T	A	7: 81,038,100	S925T	probably benign	Het

Other mutations in Ubqln3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Ubqln3	APN	7	104141777	missense	probably benign	0.00
IGL00766:Ubqln3	APN	7	104142824	missense	probably benign	0.00
IGL01451:Ubqln3	APN	7	104142196	missense	possibly damaging	0.71
IGL01673:Ubqln3	APN	7	104142398	missense	probably benign	0.12
IGL01705:Ubqln3	APN	7	104142677	missense	probably damaging	1.00
IGL01988:Ubqln3	APN	7	104142882	utr 5 prime	probably benign
IGL02008:Ubqln3	APN	7	104142316	missense	probably damaging	1.00
IGL02072:Ubqln3	APN	7	104141299	missense	possibly damaging	0.69
IGL02546:Ubqln3	APN	7	104142518	missense	probably benign	0.02
IGL02657:Ubqln3	APN	7	104141963	missense	probably damaging	0.97
IGL02682:Ubqln3	APN	7	104142065	missense	probably benign	0.19
IGL02709:Ubqln3	APN	7	104141336	missense	probably benign	0.12
IGL03357:Ubqln3	APN	7	104142556	missense	probably benign
PIT4544001:Ubqln3	UTSW	7	104141343	missense	probably damaging	0.97
R0180:Ubqln3	UTSW	7	104141840	missense	probably damaging	1.00
R0845:Ubqln3	UTSW	7	104142068	missense	probably damaging	0.98
R1019:Ubqln3	UTSW	7	104141386	missense	probably benign	0.00
R1280:Ubqln3	UTSW	7	104142076	missense	possibly damaging	0.85
R1448:Ubqln3	UTSW	7	104142790	missense	probably damaging	1.00
R1550:Ubqln3	UTSW	7	104141546	missense	probably damaging	0.98
R1617:Ubqln3	UTSW	7	104142860	missense	possibly damaging	0.95
R2060:Ubqln3	UTSW	7	104142151	missense	probably damaging	1.00
R2246:Ubqln3	UTSW	7	104142311	missense	probably damaging	1.00
R2263:Ubqln3	UTSW	7	104141635	nonsense	probably null
R2366:Ubqln3	UTSW	7	104141049	missense	probably damaging	0.99
R4232:Ubqln3	UTSW	7	104141803	missense	probably benign	0.00
R4447:Ubqln3	UTSW	7	104142814	missense	probably benign	0.31
R4509:Ubqln3	UTSW	7	104141444	missense	probably damaging	0.97
R4604:Ubqln3	UTSW	7	104142491	missense	probably benign	0.00
R5416:Ubqln3	UTSW	7	104141672	missense	probably benign	0.34
R5617:Ubqln3	UTSW	7	104142433	missense	probably damaging	0.99
R5648:Ubqln3	UTSW	7	104140910	missense	probably damaging	0.99
R5722:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5723:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5724:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5819:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5820:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5966:Ubqln3	UTSW	7	104141699	missense	probably benign	0.03
R6260:Ubqln3	UTSW	7	104142317	nonsense	probably null
R6272:Ubqln3	UTSW	7	104142178	missense	probably damaging	1.00
R6542:Ubqln3	UTSW	7	104141617	missense	probably benign	0.00
R6936:Ubqln3	UTSW	7	104142310	missense	probably damaging	1.00
R7023:Ubqln3	UTSW	7	104141423	missense	probably damaging	1.00
R7025:Ubqln3	UTSW	7	104141275	missense	probably benign	0.01
R7079:Ubqln3	UTSW	7	104141371	missense	probably benign	0.12
R7733:Ubqln3	UTSW	7	104141076	missense	probably damaging	0.98
R7764:Ubqln3	UTSW	7	104141236	missense	possibly damaging	0.52
R7919:Ubqln3	UTSW	7	104141192	missense	probably benign	0.03
R7961:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R8009:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R9619:Ubqln3	UTSW	7	104141846	missense	probably benign	0.05
R9652:Ubqln3	UTSW	7	104142755	missense	probably damaging	1.00
RF054:Ubqln3	UTSW	7	104141178	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CAGTTGGATTACACAGCATCCCCAC -3'
(R):5'- CCTGCCTAACAGGGTTGAATGGAG -3'

Sequencing Primer
(F):5'- ATTGACTCCAGAACATTGTCTCC -3'
(R):5'- CTAACAGGGTTGAATGGAGTAACAG -3'

Posted On

2014-04-24