Incidental Mutation 'R1650:Ubqln3'
ID 174183
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 039686-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R1650 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103790228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 621 (V621I)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect possibly damaging
Transcript: ENSMUST00000057254
AA Change: V621I

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: V621I

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.0%
  • 20x: 83.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T G 2: 103,532,747 (GRCm39) V515G probably damaging Het
Ark2c A C 18: 77,550,113 (GRCm39) probably null Het
Arl5a A T 2: 52,302,117 (GRCm39) I99N probably damaging Het
Atp8b1 A G 18: 64,704,620 (GRCm39) probably benign Het
Bag4 T A 8: 26,267,452 (GRCm39) Q126L probably damaging Het
Ccser1 A G 6: 61,615,474 (GRCm39) T659A probably benign Het
Cenpn A G 8: 117,661,498 (GRCm39) D199G probably damaging Het
Cfhr3 A G 1: 139,521,564 (GRCm39) noncoding transcript Het
Clca3a2 T A 3: 144,797,973 (GRCm39) H164L probably damaging Het
Col5a1 C A 2: 27,812,171 (GRCm39) S84R unknown Het
Ctsc T A 7: 87,930,634 (GRCm39) L71* probably null Het
Cyp2c70 A G 19: 40,153,921 (GRCm39) Y223H probably benign Het
Dbt A G 3: 116,328,381 (GRCm39) probably null Het
Dlg2 T C 7: 92,080,259 (GRCm39) V614A probably damaging Het
Dll4 T C 2: 119,161,611 (GRCm39) S398P probably damaging Het
Dyrk4 T C 6: 126,876,792 (GRCm39) K62E probably benign Het
Fgf22 A T 10: 79,591,023 (GRCm39) Y24F probably damaging Het
Ggt5 A G 10: 75,440,595 (GRCm39) R239G probably benign Het
Gm11360 C T 13: 28,140,379 (GRCm39) A81V unknown Het
Htr5b T A 1: 121,455,891 (GRCm39) T10S probably benign Het
Igsf10 T C 3: 59,233,583 (GRCm39) R1717G probably damaging Het
Itsn2 T A 12: 4,687,767 (GRCm39) V556D probably damaging Het
Kdm3b T C 18: 34,942,168 (GRCm39) V553A possibly damaging Het
Krt84 G A 15: 101,434,398 (GRCm39) S523F possibly damaging Het
Lca5l T C 16: 95,980,140 (GRCm39) probably null Het
Lmbrd1 T C 1: 24,750,639 (GRCm39) W171R probably damaging Het
Lrp6 T C 6: 134,445,732 (GRCm39) Y1027C probably benign Het
Macf1 A T 4: 123,350,393 (GRCm39) Y1702* probably null Het
Mon2 T C 10: 122,831,682 (GRCm39) I1675V probably benign Het
Mtcl1 T A 17: 66,692,871 (GRCm39) K486M probably damaging Het
Nek1 A T 8: 61,489,110 (GRCm39) H338L probably benign Het
Ola1 A T 2: 72,987,238 (GRCm39) D131E possibly damaging Het
Olr1 T A 6: 129,484,052 (GRCm39) M7L probably benign Het
Or1f12 T C 13: 21,721,249 (GRCm39) N294D probably damaging Het
Or4k36 C T 2: 111,146,640 (GRCm39) A272V probably benign Het
Or5t18 A T 2: 86,637,091 (GRCm39) M84K possibly damaging Het
Or5w10 C A 2: 87,375,772 (GRCm39) V39L probably benign Het
Or7g27 T G 9: 19,249,943 (GRCm39) F62L possibly damaging Het
Or9m2 C T 2: 87,821,145 (GRCm39) A230V probably benign Het
Pan2 G A 10: 128,153,768 (GRCm39) E980K probably damaging Het
Pgm1 C A 4: 99,819,276 (GRCm39) Q149K probably benign Het
Pgm1 A G 4: 99,819,267 (GRCm39) K146E possibly damaging Het
Phlpp2 T C 8: 110,660,587 (GRCm39) probably benign Het
Plekhs1 G T 19: 56,459,474 (GRCm39) G75C probably damaging Het
Plin4 G A 17: 56,411,931 (GRCm39) T700I probably damaging Het
Podxl2 G A 6: 88,826,901 (GRCm39) P71L probably benign Het
Pot1a A T 6: 25,745,964 (GRCm39) V579D probably damaging Het
Poteg A G 8: 27,953,813 (GRCm39) D318G probably benign Het
Ppp4r3a A T 12: 101,010,878 (GRCm39) D554E probably damaging Het
Proser3 G A 7: 30,239,751 (GRCm39) A451V probably damaging Het
Shld2 T A 14: 33,981,574 (GRCm39) probably benign Het
Strc T C 2: 121,211,366 (GRCm39) probably benign Het
Syce1 C A 7: 140,358,300 (GRCm39) C216F possibly damaging Het
Syne2 A T 12: 75,951,033 (GRCm39) K395* probably null Het
Trim28 G A 7: 12,764,776 (GRCm39) G831D possibly damaging Het
Tyw1 A G 5: 130,317,752 (GRCm39) I434V possibly damaging Het
Ubox5 G A 2: 130,442,345 (GRCm39) A114V probably benign Het
Unc79 A G 12: 103,079,052 (GRCm39) D1543G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Wrnip1 C A 13: 32,989,362 (GRCm39) H283Q probably benign Het
Zan A T 5: 137,392,863 (GRCm39) probably benign Het
Zcchc10 A T 11: 53,218,229 (GRCm39) K1* probably null Het
Zfp592 T A 7: 80,687,848 (GRCm39) S925T probably benign Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGTTGGATTACACAGCATCCCCAC -3'
(R):5'- CCTGCCTAACAGGGTTGAATGGAG -3'

Sequencing Primer
(F):5'- ATTGACTCCAGAACATTGTCTCC -3'
(R):5'- CTAACAGGGTTGAATGGAGTAACAG -3'
Posted On 2014-04-24