Incidental Mutation 'R1650:Syce1'
ID174184
Institutional Source Beutler Lab
Gene Symbol Syce1
Ensembl Gene ENSMUSG00000025480
Gene Namesynaptonemal complex central element protein 1
Synonyms4933406J07Rik
MMRRC Submission 039686-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1650 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140777229-140787852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 140778387 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 216 (C216F)
Ref Sequence ENSEMBL: ENSMUSP00000026553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000026553] [ENSMUST00000209253] [ENSMUST00000210235] [ENSMUST00000211616]
Predicted Effect probably benign
Transcript: ENSMUST00000026552
SMART Domains Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479

DomainStartEndE-ValueType
transmembrane domain 2 23 N/A INTRINSIC
Pfam:p450 33 489 1.4e-147 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000026553
AA Change: C216F

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026553
Gene: ENSMUSG00000025480
AA Change: C216F

DomainStartEndE-ValueType
Pfam:SYCE1 49 200 5.5e-66 PFAM
coiled coil region 237 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209253
Predicted Effect probably benign
Transcript: ENSMUST00000210235
Predicted Effect probably benign
Transcript: ENSMUST00000211616
Meta Mutation Damage Score 0.2248 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.0%
  • 20x: 83.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptonemal complex, which links homologous chromosomes during prophase I of meiosis. The tripartite structure of the complex is highly conserved amongst metazoans. It consists of two lateral elements and a central region formed by transverse elements and a central element. The protein encoded by this gene localizes to the central element and is required for initiation and elongation of the synapsis. Allelic variants of this gene have been associated with premature ovarian failure and spermatogenic failure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit small ovaries and small testes, severe defects in gametogenesis, and infertility in both sexes. Meiosis is arrested, homologous chromosomes fail to synapse, and meiotic double-strand breaks are formed but are notefficiently repaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T G 2: 103,702,402 V515G probably damaging Het
Arl5a A T 2: 52,412,105 I99N probably damaging Het
Atp8b1 A G 18: 64,571,549 probably benign Het
Bag4 T A 8: 25,777,424 Q126L probably damaging Het
Ccser1 A G 6: 61,638,490 T659A probably benign Het
Cenpn A G 8: 116,934,759 D199G probably damaging Het
Cfhr3 A G 1: 139,593,826 noncoding transcript Het
Clca2 T A 3: 145,092,212 H164L probably damaging Het
Col5a1 C A 2: 27,922,159 S84R unknown Het
Ctsc T A 7: 88,281,426 L71* probably null Het
Cyp2c70 A G 19: 40,165,477 Y223H probably benign Het
Dbt A G 3: 116,534,732 probably null Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dll4 T C 2: 119,331,130 S398P probably damaging Het
Dyrk4 T C 6: 126,899,829 K62E probably benign Het
Fam35a T A 14: 34,259,617 probably benign Het
Fgf22 A T 10: 79,755,189 Y24F probably damaging Het
Ggt5 A G 10: 75,604,761 R239G probably benign Het
Gm11360 C T 13: 27,956,396 A81V unknown Het
Htr5b T A 1: 121,528,162 T10S probably benign Het
Igsf10 T C 3: 59,326,162 R1717G probably damaging Het
Itsn2 T A 12: 4,637,767 V556D probably damaging Het
Kdm3b T C 18: 34,809,115 V553A possibly damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lca5l T C 16: 96,178,940 probably null Het
Lmbrd1 T C 1: 24,711,558 W171R probably damaging Het
Lrp6 T C 6: 134,468,769 Y1027C probably benign Het
Macf1 A T 4: 123,456,600 Y1702* probably null Het
Mon2 T C 10: 122,995,777 I1675V probably benign Het
Mtcl1 T A 17: 66,385,876 K486M probably damaging Het
Nek1 A T 8: 61,036,076 H338L probably benign Het
Ola1 A T 2: 73,156,894 D131E possibly damaging Het
Olfr1128 C A 2: 87,545,428 V39L probably benign Het
Olfr1158 C T 2: 87,990,801 A230V probably benign Het
Olfr1280 C T 2: 111,316,295 A272V probably benign Het
Olfr1366 T C 13: 21,537,079 N294D probably damaging Het
Olfr141 A T 2: 86,806,747 M84K possibly damaging Het
Olfr845 T G 9: 19,338,647 F62L possibly damaging Het
Olr1 T A 6: 129,507,089 M7L probably benign Het
Pan2 G A 10: 128,317,899 E980K probably damaging Het
Pgm2 A G 4: 99,962,070 K146E possibly damaging Het
Pgm2 C A 4: 99,962,079 Q149K probably benign Het
Phlpp2 T C 8: 109,933,955 probably benign Het
Plekhs1 G T 19: 56,471,042 G75C probably damaging Het
Plin4 G A 17: 56,104,931 T700I probably damaging Het
Podxl2 G A 6: 88,849,919 P71L probably benign Het
Pot1a A T 6: 25,745,965 V579D probably damaging Het
Poteg A G 8: 27,463,785 D318G probably benign Het
Ppp4r3a A T 12: 101,044,619 D554E probably damaging Het
Proser3 G A 7: 30,540,326 A451V probably damaging Het
Rnf165 A C 18: 77,462,417 probably null Het
Strc T C 2: 121,380,885 probably benign Het
Syne2 A T 12: 75,904,259 K395* probably null Het
Trim28 G A 7: 13,030,849 G831D possibly damaging Het
Tyw1 A G 5: 130,288,911 I434V possibly damaging Het
Ubox5 G A 2: 130,600,425 A114V probably benign Het
Ubqln3 C T 7: 104,141,021 V621I possibly damaging Het
Unc79 A G 12: 103,112,793 D1543G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Wrnip1 C A 13: 32,805,379 H283Q probably benign Het
Zan A T 5: 137,394,601 probably benign Het
Zcchc10 A T 11: 53,327,402 K1* probably null Het
Zfp592 T A 7: 81,038,100 S925T probably benign Het
Other mutations in Syce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02112:Syce1 APN 7 140779632 missense probably benign
IGL03304:Syce1 APN 7 140777710 missense possibly damaging 0.67
R0918:Syce1 UTSW 7 140780523 missense probably damaging 1.00
R1106:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R1169:Syce1 UTSW 7 140778207 missense probably benign 0.00
R1430:Syce1 UTSW 7 140779438 unclassified probably benign
R1436:Syce1 UTSW 7 140777680 missense possibly damaging 0.84
R2081:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R2082:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R3890:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R3891:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4006:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4007:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4077:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4078:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4079:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4817:Syce1 UTSW 7 140778423 missense probably benign 0.00
R4824:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R5040:Syce1 UTSW 7 140779065 missense probably damaging 1.00
R5766:Syce1 UTSW 7 140777981 missense probably damaging 1.00
R6380:Syce1 UTSW 7 140779065 missense probably damaging 1.00
R7048:Syce1 UTSW 7 140779368 missense possibly damaging 0.73
Y4338:Syce1 UTSW 7 140779896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGGAATGCCCTTTCCACAGAC -3'
(R):5'- TTTTGGACAGCAGCAAGGAGCAGC -3'

Sequencing Primer
(F):5'- CGTACTATGAGCAAGGATCTGTACC -3'
(R):5'- CTGCTCAAGGAAGGTGAGGTC -3'
Posted On2014-04-24