Incidental Mutation 'R1650:Poteg'
ID174186
Institutional Source Beutler Lab
Gene Symbol Poteg
Ensembl Gene ENSMUSG00000063932
Gene NamePOTE ankyrin domain family, member G
Synonyms
MMRRC Submission 039686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1650 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location27447670-27495172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27463785 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 318 (D318G)
Ref Sequence ENSEMBL: ENSMUSP00000147760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081321] [ENSMUST00000209669] [ENSMUST00000210427]
Predicted Effect probably benign
Transcript: ENSMUST00000081321
AA Change: D322G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080069
Gene: ENSMUSG00000063932
AA Change: D322G

DomainStartEndE-ValueType
ANK 80 109 1.46e-2 SMART
ANK 113 142 7.89e1 SMART
ANK 146 175 3.1e-6 SMART
ANK 179 208 2.81e-4 SMART
ANK 212 241 8.62e1 SMART
ANK 245 273 1.23e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209669
AA Change: D260G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000210427
AA Change: D318G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211657
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.0%
  • 20x: 83.4%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T G 2: 103,702,402 V515G probably damaging Het
Arl5a A T 2: 52,412,105 I99N probably damaging Het
Atp8b1 A G 18: 64,571,549 probably benign Het
Bag4 T A 8: 25,777,424 Q126L probably damaging Het
Ccser1 A G 6: 61,638,490 T659A probably benign Het
Cenpn A G 8: 116,934,759 D199G probably damaging Het
Cfhr3 A G 1: 139,593,826 noncoding transcript Het
Clca2 T A 3: 145,092,212 H164L probably damaging Het
Col5a1 C A 2: 27,922,159 S84R unknown Het
Ctsc T A 7: 88,281,426 L71* probably null Het
Cyp2c70 A G 19: 40,165,477 Y223H probably benign Het
Dbt A G 3: 116,534,732 probably null Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dll4 T C 2: 119,331,130 S398P probably damaging Het
Dyrk4 T C 6: 126,899,829 K62E probably benign Het
Fam35a T A 14: 34,259,617 probably benign Het
Fgf22 A T 10: 79,755,189 Y24F probably damaging Het
Ggt5 A G 10: 75,604,761 R239G probably benign Het
Gm11360 C T 13: 27,956,396 A81V unknown Het
Htr5b T A 1: 121,528,162 T10S probably benign Het
Igsf10 T C 3: 59,326,162 R1717G probably damaging Het
Itsn2 T A 12: 4,637,767 V556D probably damaging Het
Kdm3b T C 18: 34,809,115 V553A possibly damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lca5l T C 16: 96,178,940 probably null Het
Lmbrd1 T C 1: 24,711,558 W171R probably damaging Het
Lrp6 T C 6: 134,468,769 Y1027C probably benign Het
Macf1 A T 4: 123,456,600 Y1702* probably null Het
Mon2 T C 10: 122,995,777 I1675V probably benign Het
Mtcl1 T A 17: 66,385,876 K486M probably damaging Het
Nek1 A T 8: 61,036,076 H338L probably benign Het
Ola1 A T 2: 73,156,894 D131E possibly damaging Het
Olfr1128 C A 2: 87,545,428 V39L probably benign Het
Olfr1158 C T 2: 87,990,801 A230V probably benign Het
Olfr1280 C T 2: 111,316,295 A272V probably benign Het
Olfr1366 T C 13: 21,537,079 N294D probably damaging Het
Olfr141 A T 2: 86,806,747 M84K possibly damaging Het
Olfr845 T G 9: 19,338,647 F62L possibly damaging Het
Olr1 T A 6: 129,507,089 M7L probably benign Het
Pan2 G A 10: 128,317,899 E980K probably damaging Het
Pgm2 A G 4: 99,962,070 K146E possibly damaging Het
Pgm2 C A 4: 99,962,079 Q149K probably benign Het
Phlpp2 T C 8: 109,933,955 probably benign Het
Plekhs1 G T 19: 56,471,042 G75C probably damaging Het
Plin4 G A 17: 56,104,931 T700I probably damaging Het
Podxl2 G A 6: 88,849,919 P71L probably benign Het
Pot1a A T 6: 25,745,965 V579D probably damaging Het
Ppp4r3a A T 12: 101,044,619 D554E probably damaging Het
Proser3 G A 7: 30,540,326 A451V probably damaging Het
Rnf165 A C 18: 77,462,417 probably null Het
Strc T C 2: 121,380,885 probably benign Het
Syce1 C A 7: 140,778,387 C216F possibly damaging Het
Syne2 A T 12: 75,904,259 K395* probably null Het
Trim28 G A 7: 13,030,849 G831D possibly damaging Het
Tyw1 A G 5: 130,288,911 I434V possibly damaging Het
Ubox5 G A 2: 130,600,425 A114V probably benign Het
Ubqln3 C T 7: 104,141,021 V621I possibly damaging Het
Unc79 A G 12: 103,112,793 D1543G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Wrnip1 C A 13: 32,805,379 H283Q probably benign Het
Zan A T 5: 137,394,601 probably benign Het
Zcchc10 A T 11: 53,327,402 K1* probably null Het
Zfp592 T A 7: 81,038,100 S925T probably benign Het
Other mutations in Poteg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Poteg APN 8 27473620 splice site probably benign
IGL01964:Poteg APN 8 27448008 missense probably damaging 0.99
IGL03017:Poteg APN 8 27462041 missense probably benign 0.01
R0034:Poteg UTSW 8 27462077 splice site probably benign
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0522:Poteg UTSW 8 27449958 missense possibly damaging 0.95
R0634:Poteg UTSW 8 27473587 missense probably benign 0.20
R0971:Poteg UTSW 8 27447939 missense probably damaging 1.00
R1019:Poteg UTSW 8 27447824 missense possibly damaging 0.46
R1450:Poteg UTSW 8 27447843 missense probably benign 0.27
R1603:Poteg UTSW 8 27448005 start codon destroyed probably null 0.56
R1656:Poteg UTSW 8 27495032 intron probably benign
R1818:Poteg UTSW 8 27450167 nonsense probably null
R2048:Poteg UTSW 8 27456746 missense probably benign 0.39
R2847:Poteg UTSW 8 27481676 missense probably benign 0.10
R2848:Poteg UTSW 8 27481676 missense probably benign 0.10
R2849:Poteg UTSW 8 27481676 missense probably benign 0.10
R4493:Poteg UTSW 8 27480097 missense possibly damaging 0.68
R4967:Poteg UTSW 8 27494981 intron probably benign
R5051:Poteg UTSW 8 27453329 missense possibly damaging 0.78
R5149:Poteg UTSW 8 27481643 missense possibly damaging 0.93
R5579:Poteg UTSW 8 27448037 missense probably damaging 1.00
R5594:Poteg UTSW 8 27447968 missense probably benign 0.28
R5723:Poteg UTSW 8 27449992 critical splice donor site probably null
R5804:Poteg UTSW 8 27456798 missense probably damaging 1.00
R6685:Poteg UTSW 8 27447905 missense possibly damaging 0.91
R6911:Poteg UTSW 8 27450298 missense probably damaging 0.97
R7044:Poteg UTSW 8 27449895 missense probably damaging 1.00
R7096:Poteg UTSW 8 27473567 missense probably benign 0.00
R7174:Poteg UTSW 8 27453277 missense probably benign 0.36
R7287:Poteg UTSW 8 27453344 missense probably null 0.44
R7560:Poteg UTSW 8 27494960 missense probably benign
R7875:Poteg UTSW 8 27449914 missense probably benign 0.04
R7958:Poteg UTSW 8 27449914 missense probably benign 0.04
X0063:Poteg UTSW 8 27450154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTCAAGCCATATTCACTCTGACG -3'
(R):5'- GAAACAATGCAATTTCTCTTGGGCTCC -3'

Sequencing Primer
(F):5'- GCCATATTCACTCTGACGAAGAAG -3'
(R):5'- GGGCTCCATATTTTGACACATTTG -3'
Posted On2014-04-24