Incidental Mutation 'R1650:Cenpn'
ID174189
Institutional Source Beutler Lab
Gene Symbol Cenpn
Ensembl Gene ENSMUSG00000031756
Gene Namecentromere protein N
Synonyms2610510J17Rik
MMRRC Submission 039686-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R1650 (G1)
Quality Score196
Status Validated
Chromosome8
Chromosomal Location116921730-116941507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116934759 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 199 (D199G)
Ref Sequence ENSEMBL: ENSMUSP00000034205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034205] [ENSMUST00000212263] [ENSMUST00000212775]
Predicted Effect probably damaging
Transcript: ENSMUST00000034205
AA Change: D199G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034205
Gene: ENSMUSG00000031756
AA Change: D199G

DomainStartEndE-ValueType
Pfam:CENP-N 3 337 3.4e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212184
Predicted Effect possibly damaging
Transcript: ENSMUST00000212263
AA Change: D112G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000212775
Meta Mutation Damage Score 0.5374 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.0%
  • 20x: 83.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms part of the nucleosome-associated complex and is important for kinetochore assembly. It is bound to kinetochores during S phase and G2 and recruits other proteins to the centromere. Pseudogenes of this gene are located on chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T G 2: 103,702,402 V515G probably damaging Het
Arl5a A T 2: 52,412,105 I99N probably damaging Het
Atp8b1 A G 18: 64,571,549 probably benign Het
Bag4 T A 8: 25,777,424 Q126L probably damaging Het
Ccser1 A G 6: 61,638,490 T659A probably benign Het
Cfhr3 A G 1: 139,593,826 noncoding transcript Het
Clca2 T A 3: 145,092,212 H164L probably damaging Het
Col5a1 C A 2: 27,922,159 S84R unknown Het
Ctsc T A 7: 88,281,426 L71* probably null Het
Cyp2c70 A G 19: 40,165,477 Y223H probably benign Het
Dbt A G 3: 116,534,732 probably null Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dll4 T C 2: 119,331,130 S398P probably damaging Het
Dyrk4 T C 6: 126,899,829 K62E probably benign Het
Fam35a T A 14: 34,259,617 probably benign Het
Fgf22 A T 10: 79,755,189 Y24F probably damaging Het
Ggt5 A G 10: 75,604,761 R239G probably benign Het
Gm11360 C T 13: 27,956,396 A81V unknown Het
Htr5b T A 1: 121,528,162 T10S probably benign Het
Igsf10 T C 3: 59,326,162 R1717G probably damaging Het
Itsn2 T A 12: 4,637,767 V556D probably damaging Het
Kdm3b T C 18: 34,809,115 V553A possibly damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lca5l T C 16: 96,178,940 probably null Het
Lmbrd1 T C 1: 24,711,558 W171R probably damaging Het
Lrp6 T C 6: 134,468,769 Y1027C probably benign Het
Macf1 A T 4: 123,456,600 Y1702* probably null Het
Mon2 T C 10: 122,995,777 I1675V probably benign Het
Mtcl1 T A 17: 66,385,876 K486M probably damaging Het
Nek1 A T 8: 61,036,076 H338L probably benign Het
Ola1 A T 2: 73,156,894 D131E possibly damaging Het
Olfr1128 C A 2: 87,545,428 V39L probably benign Het
Olfr1158 C T 2: 87,990,801 A230V probably benign Het
Olfr1280 C T 2: 111,316,295 A272V probably benign Het
Olfr1366 T C 13: 21,537,079 N294D probably damaging Het
Olfr141 A T 2: 86,806,747 M84K possibly damaging Het
Olfr845 T G 9: 19,338,647 F62L possibly damaging Het
Olr1 T A 6: 129,507,089 M7L probably benign Het
Pan2 G A 10: 128,317,899 E980K probably damaging Het
Pgm2 A G 4: 99,962,070 K146E possibly damaging Het
Pgm2 C A 4: 99,962,079 Q149K probably benign Het
Phlpp2 T C 8: 109,933,955 probably benign Het
Plekhs1 G T 19: 56,471,042 G75C probably damaging Het
Plin4 G A 17: 56,104,931 T700I probably damaging Het
Podxl2 G A 6: 88,849,919 P71L probably benign Het
Pot1a A T 6: 25,745,965 V579D probably damaging Het
Poteg A G 8: 27,463,785 D318G probably benign Het
Ppp4r3a A T 12: 101,044,619 D554E probably damaging Het
Proser3 G A 7: 30,540,326 A451V probably damaging Het
Rnf165 A C 18: 77,462,417 probably null Het
Strc T C 2: 121,380,885 probably benign Het
Syce1 C A 7: 140,778,387 C216F possibly damaging Het
Syne2 A T 12: 75,904,259 K395* probably null Het
Trim28 G A 7: 13,030,849 G831D possibly damaging Het
Tyw1 A G 5: 130,288,911 I434V possibly damaging Het
Ubox5 G A 2: 130,600,425 A114V probably benign Het
Ubqln3 C T 7: 104,141,021 V621I possibly damaging Het
Unc79 A G 12: 103,112,793 D1543G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Wrnip1 C A 13: 32,805,379 H283Q probably benign Het
Zan A T 5: 137,394,601 probably benign Het
Zcchc10 A T 11: 53,327,402 K1* probably null Het
Zfp592 T A 7: 81,038,100 S925T probably benign Het
Other mutations in Cenpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Cenpn APN 8 116928587 splice site probably null
IGL02084:Cenpn APN 8 116940895 missense probably damaging 1.00
R0791:Cenpn UTSW 8 116940820 splice site probably benign
R0843:Cenpn UTSW 8 116933306 missense probably benign 0.09
R1166:Cenpn UTSW 8 116926207 missense probably damaging 1.00
R2132:Cenpn UTSW 8 116934797 critical splice donor site probably null
R4512:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4513:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4514:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4865:Cenpn UTSW 8 116934773 missense probably damaging 1.00
R5969:Cenpn UTSW 8 116940537 missense probably damaging 1.00
R6518:Cenpn UTSW 8 116937165 missense possibly damaging 0.88
R6795:Cenpn UTSW 8 116926148 missense probably benign 0.02
R7143:Cenpn UTSW 8 116937227 missense probably benign 0.00
R7556:Cenpn UTSW 8 116937269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTTCACTGTCAGCAGCAGG -3'
(R):5'- GGTAACGCGGGCCAATATGATCAC -3'

Sequencing Primer
(F):5'- GGAGATAGGGTTACATTTCTTCTCAC -3'
(R):5'- AAGCTTCATCCACTCGCTAGC -3'
Posted On2014-04-24