Incidental Mutation 'R1650:Wrnip1'
ID 174203
Institutional Source Beutler Lab
Gene Symbol Wrnip1
Ensembl Gene ENSMUSG00000021400
Gene Name Werner helicase interacting protein 1
Synonyms 4833444L21Rik, WHIP
MMRRC Submission 039686-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1650 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 32986021-33006592 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 32989362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 283 (H283Q)
Ref Sequence ENSEMBL: ENSMUSP00000021832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021832] [ENSMUST00000057911]
AlphaFold Q91XU0
Predicted Effect probably benign
Transcript: ENSMUST00000021832
AA Change: H283Q

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000021832
Gene: ENSMUSG00000021400
AA Change: H283Q

DomainStartEndE-ValueType
ZnF_Rad18 17 40 4.76e-10 SMART
low complexity region 90 110 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 158 183 N/A INTRINSIC
AAA 255 375 9.86e-16 SMART
Pfam:AAA_assoc_2 413 506 6.4e-26 PFAM
Pfam:MgsA_C 507 659 3.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057911
SMART Domains Protein: ENSMUSP00000050235
Gene: ENSMUSG00000042874

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 37 46 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
transmembrane domain 93 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221066
Predicted Effect probably benign
Transcript: ENSMUST00000229351
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.0%
  • 20x: 83.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Werner's syndrome is a rare autosomal recessive disorder characterized by accelerated aging that is caused by defects in the Werner syndrome ATP-dependent helicase gene (WRN). The protein encoded by this gene interacts with the exonuclease-containing N-terminal portion of the Werner protein. This protein has a ubiquitin-binding zinc-finger domain in the N-terminus, an ATPase domain, and two leucine zipper motifs in the C-terminus. It has sequence similarity to replication factor C family proteins and is conserved from E. coli to human. This protein likely accumulates at sites of DNA damage by interacting with polyubiquinated proteins and also binds to DNA polymerase delta and increases the initiation frequency of DNA polymerase delta-mediated DNA synthesis. This protein also interacts with nucleoporins at nuclear pore complexes. Two transcript variants encoding different isoforms have been isolated for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T G 2: 103,532,747 (GRCm39) V515G probably damaging Het
Ark2c A C 18: 77,550,113 (GRCm39) probably null Het
Arl5a A T 2: 52,302,117 (GRCm39) I99N probably damaging Het
Atp8b1 A G 18: 64,704,620 (GRCm39) probably benign Het
Bag4 T A 8: 26,267,452 (GRCm39) Q126L probably damaging Het
Ccser1 A G 6: 61,615,474 (GRCm39) T659A probably benign Het
Cenpn A G 8: 117,661,498 (GRCm39) D199G probably damaging Het
Cfhr3 A G 1: 139,521,564 (GRCm39) noncoding transcript Het
Clca3a2 T A 3: 144,797,973 (GRCm39) H164L probably damaging Het
Col5a1 C A 2: 27,812,171 (GRCm39) S84R unknown Het
Ctsc T A 7: 87,930,634 (GRCm39) L71* probably null Het
Cyp2c70 A G 19: 40,153,921 (GRCm39) Y223H probably benign Het
Dbt A G 3: 116,328,381 (GRCm39) probably null Het
Dlg2 T C 7: 92,080,259 (GRCm39) V614A probably damaging Het
Dll4 T C 2: 119,161,611 (GRCm39) S398P probably damaging Het
Dyrk4 T C 6: 126,876,792 (GRCm39) K62E probably benign Het
Fgf22 A T 10: 79,591,023 (GRCm39) Y24F probably damaging Het
Ggt5 A G 10: 75,440,595 (GRCm39) R239G probably benign Het
Gm11360 C T 13: 28,140,379 (GRCm39) A81V unknown Het
Htr5b T A 1: 121,455,891 (GRCm39) T10S probably benign Het
Igsf10 T C 3: 59,233,583 (GRCm39) R1717G probably damaging Het
Itsn2 T A 12: 4,687,767 (GRCm39) V556D probably damaging Het
Kdm3b T C 18: 34,942,168 (GRCm39) V553A possibly damaging Het
Krt84 G A 15: 101,434,398 (GRCm39) S523F possibly damaging Het
Lca5l T C 16: 95,980,140 (GRCm39) probably null Het
Lmbrd1 T C 1: 24,750,639 (GRCm39) W171R probably damaging Het
Lrp6 T C 6: 134,445,732 (GRCm39) Y1027C probably benign Het
Macf1 A T 4: 123,350,393 (GRCm39) Y1702* probably null Het
Mon2 T C 10: 122,831,682 (GRCm39) I1675V probably benign Het
Mtcl1 T A 17: 66,692,871 (GRCm39) K486M probably damaging Het
Nek1 A T 8: 61,489,110 (GRCm39) H338L probably benign Het
Ola1 A T 2: 72,987,238 (GRCm39) D131E possibly damaging Het
Olr1 T A 6: 129,484,052 (GRCm39) M7L probably benign Het
Or1f12 T C 13: 21,721,249 (GRCm39) N294D probably damaging Het
Or4k36 C T 2: 111,146,640 (GRCm39) A272V probably benign Het
Or5t18 A T 2: 86,637,091 (GRCm39) M84K possibly damaging Het
Or5w10 C A 2: 87,375,772 (GRCm39) V39L probably benign Het
Or7g27 T G 9: 19,249,943 (GRCm39) F62L possibly damaging Het
Or9m2 C T 2: 87,821,145 (GRCm39) A230V probably benign Het
Pan2 G A 10: 128,153,768 (GRCm39) E980K probably damaging Het
Pgm1 C A 4: 99,819,276 (GRCm39) Q149K probably benign Het
Pgm1 A G 4: 99,819,267 (GRCm39) K146E possibly damaging Het
Phlpp2 T C 8: 110,660,587 (GRCm39) probably benign Het
Plekhs1 G T 19: 56,459,474 (GRCm39) G75C probably damaging Het
Plin4 G A 17: 56,411,931 (GRCm39) T700I probably damaging Het
Podxl2 G A 6: 88,826,901 (GRCm39) P71L probably benign Het
Pot1a A T 6: 25,745,964 (GRCm39) V579D probably damaging Het
Poteg A G 8: 27,953,813 (GRCm39) D318G probably benign Het
Ppp4r3a A T 12: 101,010,878 (GRCm39) D554E probably damaging Het
Proser3 G A 7: 30,239,751 (GRCm39) A451V probably damaging Het
Shld2 T A 14: 33,981,574 (GRCm39) probably benign Het
Strc T C 2: 121,211,366 (GRCm39) probably benign Het
Syce1 C A 7: 140,358,300 (GRCm39) C216F possibly damaging Het
Syne2 A T 12: 75,951,033 (GRCm39) K395* probably null Het
Trim28 G A 7: 12,764,776 (GRCm39) G831D possibly damaging Het
Tyw1 A G 5: 130,317,752 (GRCm39) I434V possibly damaging Het
Ubox5 G A 2: 130,442,345 (GRCm39) A114V probably benign Het
Ubqln3 C T 7: 103,790,228 (GRCm39) V621I possibly damaging Het
Unc79 A G 12: 103,079,052 (GRCm39) D1543G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Zan A T 5: 137,392,863 (GRCm39) probably benign Het
Zcchc10 A T 11: 53,218,229 (GRCm39) K1* probably null Het
Zfp592 T A 7: 80,687,848 (GRCm39) S925T probably benign Het
Other mutations in Wrnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Wrnip1 APN 13 33,000,312 (GRCm39) missense probably damaging 1.00
IGL02608:Wrnip1 APN 13 32,990,857 (GRCm39) missense probably damaging 1.00
IGL02947:Wrnip1 APN 13 33,006,053 (GRCm39) missense probably damaging 1.00
R0028:Wrnip1 UTSW 13 33,004,280 (GRCm39) missense probably damaging 1.00
R0131:Wrnip1 UTSW 13 32,990,847 (GRCm39) missense probably damaging 0.98
R0212:Wrnip1 UTSW 13 33,005,889 (GRCm39) missense probably benign 0.45
R0545:Wrnip1 UTSW 13 32,990,796 (GRCm39) missense probably damaging 1.00
R0638:Wrnip1 UTSW 13 33,005,073 (GRCm39) missense possibly damaging 0.82
R1894:Wrnip1 UTSW 13 32,989,319 (GRCm39) critical splice acceptor site probably null
R2176:Wrnip1 UTSW 13 33,004,223 (GRCm39) missense probably damaging 1.00
R2371:Wrnip1 UTSW 13 32,986,410 (GRCm39) missense probably benign
R2475:Wrnip1 UTSW 13 32,990,941 (GRCm39) missense probably benign 0.30
R3122:Wrnip1 UTSW 13 32,986,744 (GRCm39) missense probably benign 0.06
R4247:Wrnip1 UTSW 13 32,990,866 (GRCm39) missense probably damaging 1.00
R4604:Wrnip1 UTSW 13 32,986,330 (GRCm39) missense probably damaging 1.00
R4978:Wrnip1 UTSW 13 33,000,295 (GRCm39) missense probably damaging 1.00
R5109:Wrnip1 UTSW 13 33,000,319 (GRCm39) missense probably damaging 1.00
R5148:Wrnip1 UTSW 13 32,990,839 (GRCm39) missense probably damaging 1.00
R5929:Wrnip1 UTSW 13 32,990,949 (GRCm39) missense probably damaging 1.00
R6750:Wrnip1 UTSW 13 32,986,739 (GRCm39) missense probably damaging 0.99
R7137:Wrnip1 UTSW 13 32,986,732 (GRCm39) missense probably benign 0.01
R7142:Wrnip1 UTSW 13 32,986,616 (GRCm39) missense possibly damaging 0.51
R7378:Wrnip1 UTSW 13 33,000,264 (GRCm39) missense probably benign 0.33
R7468:Wrnip1 UTSW 13 33,000,360 (GRCm39) missense possibly damaging 0.80
R7470:Wrnip1 UTSW 13 33,000,310 (GRCm39) nonsense probably null
R8049:Wrnip1 UTSW 13 33,005,960 (GRCm39) missense probably benign
R8260:Wrnip1 UTSW 13 32,989,339 (GRCm39) missense possibly damaging 0.80
R9000:Wrnip1 UTSW 13 32,986,711 (GRCm39) missense probably damaging 0.99
X0019:Wrnip1 UTSW 13 32,990,749 (GRCm39) missense probably damaging 1.00
X0027:Wrnip1 UTSW 13 32,986,707 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCTGTCACCCTGGCTTTGCTAAATC -3'
(R):5'- GTTGAGGATGGATGGCAAGCCTATG -3'

Sequencing Primer
(F):5'- CCTGGCTTTGCTAAATCAAGAC -3'
(R):5'- CAAGCCTATGTGTCTTGAGGAAAG -3'
Posted On 2014-04-24