Incidental Mutation 'R1650:Plekhs1'
ID174213
Institutional Source Beutler Lab
Gene Symbol Plekhs1
Ensembl Gene ENSMUSG00000035818
Gene Namepleckstrin homology domain containing, family S member 1
Synonyms9930023K05Rik
MMRRC Submission 039686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1650 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56461640-56486752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56471042 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 75 (G75C)
Ref Sequence ENSEMBL: ENSMUSP00000136674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039666] [ENSMUST00000178590] [ENSMUST00000225909]
Predicted Effect probably damaging
Transcript: ENSMUST00000039666
AA Change: G75C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035440
Gene: ENSMUSG00000035818
AA Change: G75C

DomainStartEndE-ValueType
PH 21 137 4.68e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178590
AA Change: G75C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136674
Gene: ENSMUSG00000035818
AA Change: G75C

DomainStartEndE-ValueType
PH 21 136 1.77e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224840
Predicted Effect possibly damaging
Transcript: ENSMUST00000225909
AA Change: G75C

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.0%
  • 20x: 83.4%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T G 2: 103,702,402 V515G probably damaging Het
Arl5a A T 2: 52,412,105 I99N probably damaging Het
Atp8b1 A G 18: 64,571,549 probably benign Het
Bag4 T A 8: 25,777,424 Q126L probably damaging Het
Ccser1 A G 6: 61,638,490 T659A probably benign Het
Cenpn A G 8: 116,934,759 D199G probably damaging Het
Cfhr3 A G 1: 139,593,826 noncoding transcript Het
Clca2 T A 3: 145,092,212 H164L probably damaging Het
Col5a1 C A 2: 27,922,159 S84R unknown Het
Ctsc T A 7: 88,281,426 L71* probably null Het
Cyp2c70 A G 19: 40,165,477 Y223H probably benign Het
Dbt A G 3: 116,534,732 probably null Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dll4 T C 2: 119,331,130 S398P probably damaging Het
Dyrk4 T C 6: 126,899,829 K62E probably benign Het
Fam35a T A 14: 34,259,617 probably benign Het
Fgf22 A T 10: 79,755,189 Y24F probably damaging Het
Ggt5 A G 10: 75,604,761 R239G probably benign Het
Gm11360 C T 13: 27,956,396 A81V unknown Het
Htr5b T A 1: 121,528,162 T10S probably benign Het
Igsf10 T C 3: 59,326,162 R1717G probably damaging Het
Itsn2 T A 12: 4,637,767 V556D probably damaging Het
Kdm3b T C 18: 34,809,115 V553A possibly damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lca5l T C 16: 96,178,940 probably null Het
Lmbrd1 T C 1: 24,711,558 W171R probably damaging Het
Lrp6 T C 6: 134,468,769 Y1027C probably benign Het
Macf1 A T 4: 123,456,600 Y1702* probably null Het
Mon2 T C 10: 122,995,777 I1675V probably benign Het
Mtcl1 T A 17: 66,385,876 K486M probably damaging Het
Nek1 A T 8: 61,036,076 H338L probably benign Het
Ola1 A T 2: 73,156,894 D131E possibly damaging Het
Olfr1128 C A 2: 87,545,428 V39L probably benign Het
Olfr1158 C T 2: 87,990,801 A230V probably benign Het
Olfr1280 C T 2: 111,316,295 A272V probably benign Het
Olfr1366 T C 13: 21,537,079 N294D probably damaging Het
Olfr141 A T 2: 86,806,747 M84K possibly damaging Het
Olfr845 T G 9: 19,338,647 F62L possibly damaging Het
Olr1 T A 6: 129,507,089 M7L probably benign Het
Pan2 G A 10: 128,317,899 E980K probably damaging Het
Pgm2 A G 4: 99,962,070 K146E possibly damaging Het
Pgm2 C A 4: 99,962,079 Q149K probably benign Het
Phlpp2 T C 8: 109,933,955 probably benign Het
Plin4 G A 17: 56,104,931 T700I probably damaging Het
Podxl2 G A 6: 88,849,919 P71L probably benign Het
Pot1a A T 6: 25,745,965 V579D probably damaging Het
Poteg A G 8: 27,463,785 D318G probably benign Het
Ppp4r3a A T 12: 101,044,619 D554E probably damaging Het
Proser3 G A 7: 30,540,326 A451V probably damaging Het
Rnf165 A C 18: 77,462,417 probably null Het
Strc T C 2: 121,380,885 probably benign Het
Syce1 C A 7: 140,778,387 C216F possibly damaging Het
Syne2 A T 12: 75,904,259 K395* probably null Het
Trim28 G A 7: 13,030,849 G831D possibly damaging Het
Tyw1 A G 5: 130,288,911 I434V possibly damaging Het
Ubox5 G A 2: 130,600,425 A114V probably benign Het
Ubqln3 C T 7: 104,141,021 V621I possibly damaging Het
Unc79 A G 12: 103,112,793 D1543G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Wrnip1 C A 13: 32,805,379 H283Q probably benign Het
Zan A T 5: 137,394,601 probably benign Het
Zcchc10 A T 11: 53,327,402 K1* probably null Het
Zfp592 T A 7: 81,038,100 S925T probably benign Het
Other mutations in Plekhs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Plekhs1 APN 19 56464599 critical splice donor site probably null
IGL01387:Plekhs1 APN 19 56470971 missense probably benign 0.00
IGL02506:Plekhs1 APN 19 56471766 missense probably damaging 1.00
FR4304:Plekhs1 UTSW 19 56479858 unclassified probably benign
FR4340:Plekhs1 UTSW 19 56479858 unclassified probably benign
FR4342:Plekhs1 UTSW 19 56479858 unclassified probably benign
FR4342:Plekhs1 UTSW 19 56479861 unclassified probably benign
FR4589:Plekhs1 UTSW 19 56479863 unclassified probably benign
FR4737:Plekhs1 UTSW 19 56479863 unclassified probably benign
IGL03052:Plekhs1 UTSW 19 56470757 missense probably benign 0.43
R0023:Plekhs1 UTSW 19 56478516 missense probably damaging 0.99
R0023:Plekhs1 UTSW 19 56478516 missense probably damaging 0.99
R0100:Plekhs1 UTSW 19 56478502 missense probably damaging 1.00
R0100:Plekhs1 UTSW 19 56478502 missense probably damaging 1.00
R0129:Plekhs1 UTSW 19 56477290 critical splice donor site probably null
R0498:Plekhs1 UTSW 19 56481104 unclassified probably null
R1264:Plekhs1 UTSW 19 56485763 missense probably benign
R1528:Plekhs1 UTSW 19 56479995 missense probably damaging 1.00
R1820:Plekhs1 UTSW 19 56478522 missense possibly damaging 0.48
R2884:Plekhs1 UTSW 19 56470826 missense probably benign 0.01
R3237:Plekhs1 UTSW 19 56464600 splice site probably null
R4395:Plekhs1 UTSW 19 56479894 missense probably benign
R4825:Plekhs1 UTSW 19 56473268 splice site probably null
R5484:Plekhs1 UTSW 19 56479828 missense possibly damaging 0.82
R5511:Plekhs1 UTSW 19 56485792 missense probably damaging 0.97
R7105:Plekhs1 UTSW 19 56477215 missense probably damaging 0.99
R7267:Plekhs1 UTSW 19 56470777 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTCTTCTGAGCTTTAACTGAACTGC -3'
(R):5'- ACGAAGCTACAGATTTCATTGACCCAC -3'

Sequencing Primer
(F):5'- CTGAGCTTTAACTGAACTGCAAAAC -3'
(R):5'- GCTCTCTGTCACCAGGAAGTTAAG -3'
Posted On2014-04-24