Incidental Mutation 'R1616:Nop14'
ID174241
Institutional Source Beutler Lab
Gene Symbol Nop14
Ensembl Gene ENSMUSG00000036693
Gene NameNOP14 nucleolar protein
SynonymsNol14, 2610033H07Rik
MMRRC Submission 039653-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R1616 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34638536-34660148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34650413 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 402 (Q402K)
Ref Sequence ENSEMBL: ENSMUSP00000038382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041364]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041364
AA Change: Q402K

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038382
Gene: ENSMUSG00000036693
AA Change: Q402K

DomainStartEndE-ValueType
Pfam:Nop14 21 849 2.2e-273 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152393
Predicted Effect probably benign
Transcript: ENSMUST00000201897
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in pre-18s rRNA processing and small ribosomal subunit assembly. The encoded protein may be involved in the regulation of pancreatic cancer cell proliferation and migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,311,341 probably benign Het
A1cf A G 19: 31,934,775 E430G probably damaging Het
Aacs T A 5: 125,484,526 probably null Het
Acot12 G A 13: 91,772,767 V331I probably benign Het
Acp7 A G 7: 28,611,078 W445R probably damaging Het
Actl11 C A 9: 107,931,936 Q1153K probably benign Het
Actr8 A G 14: 29,982,644 T34A possibly damaging Het
Ahnak A G 19: 9,008,987 D2545G possibly damaging Het
Ap5z1 A G 5: 142,472,236 Y388C probably benign Het
Apol7a C T 15: 77,389,606 G219S probably damaging Het
Arid1b T A 17: 5,339,294 I1705N probably damaging Het
Bod1l T C 5: 41,808,715 Q2669R probably benign Het
Braf A T 6: 39,643,133 S504T probably benign Het
Cbl A T 9: 44,152,900 Y780N probably damaging Het
Cd86 T C 16: 36,628,976 I20V probably benign Het
Cep290 T G 10: 100,568,836 D2353E probably benign Het
Ckmt2 G A 13: 91,859,209 R289C probably benign Het
Col3a1 T C 1: 45,328,488 probably null Het
Cyp4f16 T A 17: 32,542,968 Y163* probably null Het
Dimt1 T C 13: 106,953,450 V227A possibly damaging Het
Dnah6 A T 6: 73,100,112 M2338K probably benign Het
Dock4 T G 12: 40,669,045 I274S probably damaging Het
Enthd1 T C 15: 80,452,385 D616G probably damaging Het
Fignl2 T C 15: 101,054,116 E95G probably damaging Het
Foxn1 A G 11: 78,358,866 M611T probably benign Het
Foxs1 T C 2: 152,932,639 S165G probably benign Het
Fzd3 G T 14: 65,235,507 Q271K probably benign Het
Hadhb A T 5: 30,166,715 I55F probably damaging Het
Hipk3 G A 2: 104,433,745 Q824* probably null Het
Hps1 G A 19: 42,767,185 R201W probably damaging Het
Kif21b T C 1: 136,171,685 S1477P probably damaging Het
Kif26a A T 12: 112,157,246 probably null Het
Krt90 T C 15: 101,560,591 E172G possibly damaging Het
Lama4 T G 10: 39,075,450 F1064V probably damaging Het
Leng9 A G 7: 4,148,903 V258A probably benign Het
Lgi2 A C 5: 52,546,638 V217G probably benign Het
Lpgat1 T C 1: 191,763,629 I310T possibly damaging Het
Ltbp3 A G 19: 5,746,967 Y374C probably damaging Het
Magi2 C A 5: 20,609,326 T1075K probably damaging Het
Man2c1 T C 9: 57,135,509 I221T probably benign Het
Mydgf A G 17: 56,179,415 M72T possibly damaging Het
Myo1b T C 1: 51,776,315 N624S probably damaging Het
Myo5c T A 9: 75,296,017 M1465K probably damaging Het
Nek4 A T 14: 30,987,137 D716V probably damaging Het
Nfxl1 T A 5: 72,529,037 Q607L probably benign Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Npy5r C G 8: 66,681,400 C247S probably damaging Het
Nrap T A 19: 56,389,823 I19F probably damaging Het
Olfr1189 A G 2: 88,592,008 D68G probably damaging Het
Olfr1336 T G 7: 6,460,745 S79A probably damaging Het
Olfr574 T A 7: 102,948,514 N16K probably damaging Het
Pcdh9 A T 14: 93,886,969 Y588* probably null Het
Ppp1r12a A G 10: 108,260,867 E183G probably damaging Het
Ppp2r2b T A 18: 42,688,310 H261L probably benign Het
Ptch1 G T 13: 63,539,842 T374K possibly damaging Het
Ptpn13 A T 5: 103,565,237 N1742I possibly damaging Het
Rab33a C T X: 48,519,644 S15L probably benign Het
Ralb T C 1: 119,478,014 Y75C probably damaging Het
Rassf7 T A 7: 141,216,732 V2D probably damaging Het
Rbm10 A G X: 20,645,991 N397S probably benign Het
Rbm15 T C 3: 107,330,881 T734A probably benign Het
Rbm8a G T 3: 96,631,730 probably benign Het
Rock2 T C 12: 16,972,985 I1095T probably benign Het
Rxfp3 T A 15: 11,036,303 T328S probably damaging Het
Sec31a T A 5: 100,386,195 K505N possibly damaging Het
Selenof A G 3: 144,596,881 *122W probably null Het
Sh3pxd2b T C 11: 32,381,441 M55T possibly damaging Het
Slc15a2 T C 16: 36,754,481 D522G probably benign Het
Slc2a1 T C 4: 119,136,306 F447L probably damaging Het
Slc45a2 T A 15: 11,022,128 C319S probably null Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stab2 A T 10: 86,885,718 probably null Het
Tanc1 A G 2: 59,785,387 D246G probably damaging Het
Tekt3 T G 11: 63,087,198 probably null Het
Them5 G A 3: 94,346,260 probably null Het
Tlr4 T A 4: 66,839,480 F170Y probably damaging Het
Tmem214 T G 5: 30,871,563 Y165* probably null Het
Tmem94 T C 11: 115,796,145 probably null Het
Tom1l1 A G 11: 90,656,351 L301S possibly damaging Het
Trpm3 A G 19: 22,982,712 E1237G probably damaging Het
Ube2d1 C A 10: 71,256,693 C107F probably damaging Het
Ugt3a1 C T 15: 9,306,244 R160* probably null Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Virma T C 4: 11,544,954 F1638L probably damaging Het
Vmn1r31 G A 6: 58,472,058 T274I probably damaging Het
Xylt2 C T 11: 94,668,209 S445N probably damaging Het
Zfp457 A G 13: 67,296,311 F43L possibly damaging Het
Zfp879 T A 11: 50,832,646 M455L probably benign Het
Other mutations in Nop14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Nop14 APN 5 34641313 unclassified probably benign
IGL00985:Nop14 APN 5 34644789 missense probably damaging 0.98
IGL01626:Nop14 APN 5 34649345 nonsense probably null
IGL02676:Nop14 APN 5 34639221 missense probably damaging 0.97
IGL03189:Nop14 APN 5 34650628 unclassified probably benign
IGL03047:Nop14 UTSW 5 34660014 missense possibly damaging 0.93
R0025:Nop14 UTSW 5 34643953 missense probably benign 0.08
R0831:Nop14 UTSW 5 34650520 missense possibly damaging 0.70
R1027:Nop14 UTSW 5 34644004 missense probably damaging 0.99
R1252:Nop14 UTSW 5 34650555 missense probably benign
R1845:Nop14 UTSW 5 34650328 missense possibly damaging 0.82
R2032:Nop14 UTSW 5 34659939 missense possibly damaging 0.65
R3693:Nop14 UTSW 5 34654438 missense probably damaging 0.98
R4033:Nop14 UTSW 5 34650517 missense probably benign
R4168:Nop14 UTSW 5 34656744 missense probably damaging 0.99
R4172:Nop14 UTSW 5 34650607 missense probably damaging 0.99
R4618:Nop14 UTSW 5 34639218 missense probably damaging 1.00
R4936:Nop14 UTSW 5 34652393 missense probably damaging 1.00
R6067:Nop14 UTSW 5 34657951 missense probably damaging 1.00
R6075:Nop14 UTSW 5 34659891 missense probably damaging 1.00
R6078:Nop14 UTSW 5 34657951 missense probably damaging 1.00
R6284:Nop14 UTSW 5 34641491 unclassified probably null
R7295:Nop14 UTSW 5 34639032 missense probably damaging 0.99
R7585:Nop14 UTSW 5 34644780 missense probably damaging 1.00
R7626:Nop14 UTSW 5 34651791 missense probably damaging 0.99
U15987:Nop14 UTSW 5 34657951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCAGAGAAATGTGACCATGCAC -3'
(R):5'- CACTTGGGGAACTAACGGAAGCAC -3'

Sequencing Primer
(F):5'- TCACAACTGCATCTCCAGGG -3'
(R):5'- TTCTAACTGAGGTCAGCATGG -3'
Posted On2014-04-24