Incidental Mutation 'R1616:Cep290'
ID 174271
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Name centrosomal protein 290
Synonyms Kiaa, Nphp6, b2b1752Clo, b2b1454Clo
MMRRC Submission 039653-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R1616 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 100323410-100409527 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 100404698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2353 (D2353E)
Ref Sequence ENSEMBL: ENSMUSP00000151388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054471] [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
AlphaFold Q6A078
Predicted Effect probably benign
Transcript: ENSMUST00000054471
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: D2353E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: D2353E

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218000
Predicted Effect probably benign
Transcript: ENSMUST00000218328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219643
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: D2346E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219889
Predicted Effect probably benign
Transcript: ENSMUST00000220346
AA Change: D2353E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,187,087 (GRCm39) probably benign Het
A1cf A G 19: 31,912,175 (GRCm39) E430G probably damaging Het
Aacs T A 5: 125,561,590 (GRCm39) probably null Het
Acot12 G A 13: 91,920,886 (GRCm39) V331I probably benign Het
Acp7 A G 7: 28,310,503 (GRCm39) W445R probably damaging Het
Actl11 C A 9: 107,809,135 (GRCm39) Q1153K probably benign Het
Actr8 A G 14: 29,704,601 (GRCm39) T34A possibly damaging Het
Ahnak A G 19: 8,986,351 (GRCm39) D2545G possibly damaging Het
Ap5z1 A G 5: 142,457,991 (GRCm39) Y388C probably benign Het
Apol7a C T 15: 77,273,806 (GRCm39) G219S probably damaging Het
Arid1b T A 17: 5,389,569 (GRCm39) I1705N probably damaging Het
Bod1l T C 5: 41,966,058 (GRCm39) Q2669R probably benign Het
Braf A T 6: 39,620,067 (GRCm39) S504T probably benign Het
Cbl A T 9: 44,064,197 (GRCm39) Y780N probably damaging Het
Cd86 T C 16: 36,449,338 (GRCm39) I20V probably benign Het
Ckmt2 G A 13: 92,007,328 (GRCm39) R289C probably benign Het
Col3a1 T C 1: 45,367,648 (GRCm39) probably null Het
Cyp4f16 T A 17: 32,761,942 (GRCm39) Y163* probably null Het
Dimt1 T C 13: 107,089,958 (GRCm39) V227A possibly damaging Het
Dnah6 A T 6: 73,077,095 (GRCm39) M2338K probably benign Het
Dock4 T G 12: 40,719,044 (GRCm39) I274S probably damaging Het
Enthd1 T C 15: 80,336,586 (GRCm39) D616G probably damaging Het
Fignl2 T C 15: 100,951,997 (GRCm39) E95G probably damaging Het
Foxn1 A G 11: 78,249,692 (GRCm39) M611T probably benign Het
Foxs1 T C 2: 152,774,559 (GRCm39) S165G probably benign Het
Fzd3 G T 14: 65,472,956 (GRCm39) Q271K probably benign Het
Hadhb A T 5: 30,371,713 (GRCm39) I55F probably damaging Het
Hipk3 G A 2: 104,264,090 (GRCm39) Q824* probably null Het
Hps1 G A 19: 42,755,624 (GRCm39) R201W probably damaging Het
Kif21b T C 1: 136,099,423 (GRCm39) S1477P probably damaging Het
Kif26a A T 12: 112,123,680 (GRCm39) probably null Het
Krt90 T C 15: 101,469,026 (GRCm39) E172G possibly damaging Het
Lama4 T G 10: 38,951,446 (GRCm39) F1064V probably damaging Het
Leng9 A G 7: 4,151,902 (GRCm39) V258A probably benign Het
Lgi2 A C 5: 52,703,980 (GRCm39) V217G probably benign Het
Lpgat1 T C 1: 191,495,741 (GRCm39) I310T possibly damaging Het
Ltbp3 A G 19: 5,796,995 (GRCm39) Y374C probably damaging Het
Magi2 C A 5: 20,814,324 (GRCm39) T1075K probably damaging Het
Man2c1 T C 9: 57,042,793 (GRCm39) I221T probably benign Het
Mydgf A G 17: 56,486,415 (GRCm39) M72T possibly damaging Het
Myo1b T C 1: 51,815,474 (GRCm39) N624S probably damaging Het
Myo5c T A 9: 75,203,299 (GRCm39) M1465K probably damaging Het
Nek4 A T 14: 30,709,094 (GRCm39) D716V probably damaging Het
Nfxl1 T A 5: 72,686,380 (GRCm39) Q607L probably benign Het
Nlrp9c A T 7: 26,083,862 (GRCm39) D572E probably benign Het
Nop14 G T 5: 34,807,757 (GRCm39) Q402K possibly damaging Het
Npy5r C G 8: 67,134,052 (GRCm39) C247S probably damaging Het
Nrap T A 19: 56,378,255 (GRCm39) I19F probably damaging Het
Or4c102 A G 2: 88,422,352 (GRCm39) D68G probably damaging Het
Or51t4 T A 7: 102,597,721 (GRCm39) N16K probably damaging Het
Or6z3 T G 7: 6,463,744 (GRCm39) S79A probably damaging Het
Pcdh9 A T 14: 94,124,405 (GRCm39) Y588* probably null Het
Ppp1r12a A G 10: 108,096,728 (GRCm39) E183G probably damaging Het
Ppp2r2b T A 18: 42,821,375 (GRCm39) H261L probably benign Het
Ptch1 G T 13: 63,687,656 (GRCm39) T374K possibly damaging Het
Ptpn13 A T 5: 103,713,103 (GRCm39) N1742I possibly damaging Het
Rab33a C T X: 47,608,521 (GRCm39) S15L probably benign Het
Ralb T C 1: 119,405,744 (GRCm39) Y75C probably damaging Het
Rassf7 T A 7: 140,796,645 (GRCm39) V2D probably damaging Het
Rbm10 A G X: 20,512,230 (GRCm39) N397S probably benign Het
Rbm15 T C 3: 107,238,197 (GRCm39) T734A probably benign Het
Rbm8a G T 3: 96,539,046 (GRCm39) probably benign Het
Rock2 T C 12: 17,022,986 (GRCm39) I1095T probably benign Het
Rxfp3 T A 15: 11,036,389 (GRCm39) T328S probably damaging Het
Sec31a T A 5: 100,534,054 (GRCm39) K505N possibly damaging Het
Selenof A G 3: 144,302,642 (GRCm39) *122W probably null Het
Sh3pxd2b T C 11: 32,331,441 (GRCm39) M55T possibly damaging Het
Slc15a2 T C 16: 36,574,843 (GRCm39) D522G probably benign Het
Slc2a1 T C 4: 118,993,503 (GRCm39) F447L probably damaging Het
Slc45a2 T A 15: 11,022,214 (GRCm39) C319S probably null Het
Smad4 T C 18: 73,773,333 (GRCm39) D551G probably benign Het
Smarcc2 A G 10: 128,318,662 (GRCm39) Y648C probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Stab2 A T 10: 86,721,582 (GRCm39) probably null Het
Tanc1 A G 2: 59,615,731 (GRCm39) D246G probably damaging Het
Tekt3 T G 11: 62,978,024 (GRCm39) probably null Het
Them5 G A 3: 94,253,567 (GRCm39) probably null Het
Tlr4 T A 4: 66,757,717 (GRCm39) F170Y probably damaging Het
Tmem214 T G 5: 31,028,907 (GRCm39) Y165* probably null Het
Tmem94 T C 11: 115,686,971 (GRCm39) probably null Het
Tom1l1 A G 11: 90,547,177 (GRCm39) L301S possibly damaging Het
Trpm3 A G 19: 22,960,076 (GRCm39) E1237G probably damaging Het
Ube2d1 C A 10: 71,092,523 (GRCm39) C107F probably damaging Het
Ugt3a1 C T 15: 9,306,330 (GRCm39) R160* probably null Het
Vcan G A 13: 89,853,782 (GRCm39) P393S probably damaging Het
Virma T C 4: 11,544,954 (GRCm39) F1638L probably damaging Het
Vmn1r31 G A 6: 58,449,043 (GRCm39) T274I probably damaging Het
Xylt2 C T 11: 94,559,035 (GRCm39) S445N probably damaging Het
Zfp457 A G 13: 67,444,375 (GRCm39) F43L possibly damaging Het
Zfp879 T A 11: 50,723,473 (GRCm39) M455L probably benign Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100,344,586 (GRCm39) missense probably benign 0.00
IGL00499:Cep290 APN 10 100,379,189 (GRCm39) missense probably damaging 1.00
IGL00547:Cep290 APN 10 100,346,570 (GRCm39) missense probably damaging 0.99
IGL00573:Cep290 APN 10 100,376,223 (GRCm39) missense probably damaging 1.00
IGL00646:Cep290 APN 10 100,337,016 (GRCm39) missense probably benign 0.15
IGL00755:Cep290 APN 10 100,366,966 (GRCm39) missense probably damaging 1.00
IGL00835:Cep290 APN 10 100,399,242 (GRCm39) nonsense probably null
IGL00846:Cep290 APN 10 100,376,195 (GRCm39) splice site probably benign
IGL00985:Cep290 APN 10 100,403,023 (GRCm39) splice site probably benign
IGL01687:Cep290 APN 10 100,336,067 (GRCm39) missense probably damaging 1.00
IGL01782:Cep290 APN 10 100,380,987 (GRCm39) nonsense probably null
IGL02010:Cep290 APN 10 100,397,207 (GRCm39) missense probably benign 0.00
IGL02010:Cep290 APN 10 100,344,569 (GRCm39) missense probably benign 0.39
IGL02036:Cep290 APN 10 100,393,962 (GRCm39) nonsense probably null
IGL02039:Cep290 APN 10 100,350,464 (GRCm39) critical splice donor site probably null
IGL02532:Cep290 APN 10 100,380,927 (GRCm39) missense probably benign 0.04
IGL02950:Cep290 APN 10 100,376,191 (GRCm39) splice site probably benign
IGL03105:Cep290 APN 10 100,387,686 (GRCm39) missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100,403,950 (GRCm39) missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100,373,663 (GRCm39) missense probably benign 0.09
IGL03401:Cep290 APN 10 100,336,127 (GRCm39) missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100,373,453 (GRCm39) missense probably benign 0.28
R0025:Cep290 UTSW 10 100,373,693 (GRCm39) missense probably damaging 1.00
R0127:Cep290 UTSW 10 100,372,787 (GRCm39) splice site probably benign
R0254:Cep290 UTSW 10 100,350,436 (GRCm39) missense probably benign 0.31
R0295:Cep290 UTSW 10 100,373,683 (GRCm39) missense probably damaging 0.99
R0371:Cep290 UTSW 10 100,354,426 (GRCm39) splice site probably benign
R0390:Cep290 UTSW 10 100,344,620 (GRCm39) missense probably benign 0.09
R0399:Cep290 UTSW 10 100,390,262 (GRCm39) splice site probably benign
R0413:Cep290 UTSW 10 100,359,176 (GRCm39) nonsense probably null
R0427:Cep290 UTSW 10 100,352,041 (GRCm39) missense probably benign 0.01
R0472:Cep290 UTSW 10 100,387,317 (GRCm39) missense probably benign 0.19
R0485:Cep290 UTSW 10 100,385,206 (GRCm39) missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100,328,538 (GRCm39) missense probably damaging 1.00
R0675:Cep290 UTSW 10 100,404,675 (GRCm39) critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100,354,624 (GRCm39) missense probably benign 0.08
R1238:Cep290 UTSW 10 100,353,725 (GRCm39) missense probably damaging 1.00
R1297:Cep290 UTSW 10 100,374,962 (GRCm39) splice site probably benign
R1368:Cep290 UTSW 10 100,330,828 (GRCm39) splice site probably benign
R1394:Cep290 UTSW 10 100,373,391 (GRCm39) missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100,407,963 (GRCm39) missense probably benign 0.00
R1493:Cep290 UTSW 10 100,398,043 (GRCm39) missense probably benign 0.21
R1496:Cep290 UTSW 10 100,374,828 (GRCm39) missense probably damaging 1.00
R1539:Cep290 UTSW 10 100,332,690 (GRCm39) missense probably benign 0.06
R1598:Cep290 UTSW 10 100,385,191 (GRCm39) missense probably damaging 1.00
R1712:Cep290 UTSW 10 100,390,361 (GRCm39) missense probably benign 0.02
R1753:Cep290 UTSW 10 100,349,843 (GRCm39) missense probably benign
R1773:Cep290 UTSW 10 100,346,435 (GRCm39) missense probably benign
R1775:Cep290 UTSW 10 100,332,672 (GRCm39) missense probably damaging 0.98
R1799:Cep290 UTSW 10 100,352,058 (GRCm39) missense probably benign 0.00
R1937:Cep290 UTSW 10 100,333,815 (GRCm39) missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100,367,046 (GRCm39) missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100,348,262 (GRCm39) critical splice donor site probably null
R2164:Cep290 UTSW 10 100,354,657 (GRCm39) missense probably damaging 0.96
R2393:Cep290 UTSW 10 100,397,100 (GRCm39) critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100,373,299 (GRCm39) missense probably benign 0.19
R3612:Cep290 UTSW 10 100,377,443 (GRCm39) nonsense probably null
R3800:Cep290 UTSW 10 100,408,803 (GRCm39) missense probably damaging 0.97
R4005:Cep290 UTSW 10 100,374,870 (GRCm39) missense probably damaging 1.00
R4039:Cep290 UTSW 10 100,348,263 (GRCm39) critical splice donor site probably null
R4259:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4260:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4319:Cep290 UTSW 10 100,374,909 (GRCm39) missense probably benign 0.09
R4329:Cep290 UTSW 10 100,373,530 (GRCm39) missense probably damaging 0.98
R4573:Cep290 UTSW 10 100,354,712 (GRCm39) missense probably benign
R4614:Cep290 UTSW 10 100,395,549 (GRCm39) missense possibly damaging 0.93
R4614:Cep290 UTSW 10 100,344,602 (GRCm39) missense probably benign
R4708:Cep290 UTSW 10 100,359,126 (GRCm39) missense probably benign 0.02
R4727:Cep290 UTSW 10 100,399,132 (GRCm39) missense probably benign 0.05
R4825:Cep290 UTSW 10 100,324,210 (GRCm39) missense probably damaging 0.96
R4839:Cep290 UTSW 10 100,344,648 (GRCm39) missense probably damaging 0.99
R4858:Cep290 UTSW 10 100,330,773 (GRCm39) missense probably benign 0.31
R4871:Cep290 UTSW 10 100,384,776 (GRCm39) missense probably benign 0.22
R5094:Cep290 UTSW 10 100,402,892 (GRCm39) missense probably damaging 0.97
R5103:Cep290 UTSW 10 100,374,882 (GRCm39) missense probably damaging 1.00
R5499:Cep290 UTSW 10 100,373,515 (GRCm39) missense probably damaging 0.99
R5505:Cep290 UTSW 10 100,335,048 (GRCm39) critical splice donor site probably null
R5615:Cep290 UTSW 10 100,367,012 (GRCm39) missense probably damaging 1.00
R5815:Cep290 UTSW 10 100,393,970 (GRCm39) missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100,359,261 (GRCm39) missense probably benign 0.44
R5889:Cep290 UTSW 10 100,334,936 (GRCm39) missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100,387,692 (GRCm39) missense probably damaging 0.99
R5992:Cep290 UTSW 10 100,379,183 (GRCm39) missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100,377,649 (GRCm39) missense probably damaging 1.00
R6213:Cep290 UTSW 10 100,359,222 (GRCm39) missense probably benign 0.06
R6274:Cep290 UTSW 10 100,366,069 (GRCm39) missense probably damaging 1.00
R6285:Cep290 UTSW 10 100,359,191 (GRCm39) missense probably benign 0.17
R6306:Cep290 UTSW 10 100,367,028 (GRCm39) missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100,344,638 (GRCm39) missense probably benign 0.01
R6649:Cep290 UTSW 10 100,354,393 (GRCm39) missense probably benign 0.28
R6692:Cep290 UTSW 10 100,405,006 (GRCm39) splice site probably null
R6788:Cep290 UTSW 10 100,324,490 (GRCm39) missense probably damaging 1.00
R6847:Cep290 UTSW 10 100,399,281 (GRCm39) missense probably damaging 1.00
R6947:Cep290 UTSW 10 100,365,918 (GRCm39) missense probably damaging 1.00
R7035:Cep290 UTSW 10 100,334,933 (GRCm39) missense probably benign 0.07
R7073:Cep290 UTSW 10 100,374,865 (GRCm39) missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100,379,220 (GRCm39) missense probably damaging 0.98
R7256:Cep290 UTSW 10 100,382,360 (GRCm39) missense probably damaging 1.00
R7258:Cep290 UTSW 10 100,334,970 (GRCm39) missense probably benign 0.01
R7311:Cep290 UTSW 10 100,373,580 (GRCm39) missense probably damaging 0.98
R7505:Cep290 UTSW 10 100,352,127 (GRCm39) missense probably benign 0.01
R7615:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7643:Cep290 UTSW 10 100,373,415 (GRCm39) missense probably benign
R7662:Cep290 UTSW 10 100,373,665 (GRCm39) missense probably benign 0.21
R7663:Cep290 UTSW 10 100,390,398 (GRCm39) critical splice donor site probably null
R7685:Cep290 UTSW 10 100,375,919 (GRCm39) missense probably benign 0.19
R7699:Cep290 UTSW 10 100,376,231 (GRCm39) missense probably benign 0.33
R7717:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7747:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R7757:Cep290 UTSW 10 100,399,296 (GRCm39) missense probably benign
R7843:Cep290 UTSW 10 100,352,050 (GRCm39) missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100,390,352 (GRCm39) missense probably benign
R8078:Cep290 UTSW 10 100,408,749 (GRCm39) missense probably benign 0.04
R8081:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R8094:Cep290 UTSW 10 100,380,793 (GRCm39) missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100,395,533 (GRCm39) missense probably benign 0.08
R8305:Cep290 UTSW 10 100,380,796 (GRCm39) missense probably benign 0.09
R8325:Cep290 UTSW 10 100,353,670 (GRCm39) missense probably benign 0.03
R8372:Cep290 UTSW 10 100,385,203 (GRCm39) missense probably benign 0.00
R8443:Cep290 UTSW 10 100,331,706 (GRCm39) missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100,387,320 (GRCm39) missense probably damaging 1.00
R8778:Cep290 UTSW 10 100,350,374 (GRCm39) nonsense probably null
R8975:Cep290 UTSW 10 100,349,782 (GRCm39) missense possibly damaging 0.54
R9146:Cep290 UTSW 10 100,377,665 (GRCm39) missense probably benign 0.44
R9264:Cep290 UTSW 10 100,333,878 (GRCm39) missense possibly damaging 0.86
R9374:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9448:Cep290 UTSW 10 100,395,546 (GRCm39) missense probably benign 0.32
R9499:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9507:Cep290 UTSW 10 100,330,785 (GRCm39) missense possibly damaging 0.81
R9539:Cep290 UTSW 10 100,404,713 (GRCm39) missense probably damaging 1.00
R9547:Cep290 UTSW 10 100,380,841 (GRCm39) missense probably benign 0.00
R9551:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9657:Cep290 UTSW 10 100,351,003 (GRCm39) missense possibly damaging 0.93
R9731:Cep290 UTSW 10 100,346,404 (GRCm39) missense probably damaging 0.98
R9756:Cep290 UTSW 10 100,352,034 (GRCm39) missense probably damaging 0.97
R9777:Cep290 UTSW 10 100,354,529 (GRCm39) missense probably benign 0.01
Z1176:Cep290 UTSW 10 100,385,236 (GRCm39) critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100,374,859 (GRCm39) missense possibly damaging 0.89
Z1177:Cep290 UTSW 10 100,333,806 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGGAATTGGCAGCATTGAAACC -3'
(R):5'- GCCACGTAGGAGTCTGATAAATGGG -3'

Sequencing Primer
(F):5'- AATATTTACCTTGATGACCCTATGCC -3'
(R):5'- GCATGTGGGGCTATTCAGAAC -3'
Posted On 2014-04-24