Incidental Mutation 'R1616:Dock4'
ID 174284
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 039653-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R1616 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 40719044 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 274 (I274S)
Ref Sequence ENSEMBL: ENSMUSP00000047387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably damaging
Transcript: ENSMUST00000037488
AA Change: I274S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: I274S

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220912
AA Change: I274S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,187,087 (GRCm39) probably benign Het
A1cf A G 19: 31,912,175 (GRCm39) E430G probably damaging Het
Aacs T A 5: 125,561,590 (GRCm39) probably null Het
Acot12 G A 13: 91,920,886 (GRCm39) V331I probably benign Het
Acp7 A G 7: 28,310,503 (GRCm39) W445R probably damaging Het
Actl11 C A 9: 107,809,135 (GRCm39) Q1153K probably benign Het
Actr8 A G 14: 29,704,601 (GRCm39) T34A possibly damaging Het
Ahnak A G 19: 8,986,351 (GRCm39) D2545G possibly damaging Het
Ap5z1 A G 5: 142,457,991 (GRCm39) Y388C probably benign Het
Apol7a C T 15: 77,273,806 (GRCm39) G219S probably damaging Het
Arid1b T A 17: 5,389,569 (GRCm39) I1705N probably damaging Het
Bod1l T C 5: 41,966,058 (GRCm39) Q2669R probably benign Het
Braf A T 6: 39,620,067 (GRCm39) S504T probably benign Het
Cbl A T 9: 44,064,197 (GRCm39) Y780N probably damaging Het
Cd86 T C 16: 36,449,338 (GRCm39) I20V probably benign Het
Cep290 T G 10: 100,404,698 (GRCm39) D2353E probably benign Het
Ckmt2 G A 13: 92,007,328 (GRCm39) R289C probably benign Het
Col3a1 T C 1: 45,367,648 (GRCm39) probably null Het
Cyp4f16 T A 17: 32,761,942 (GRCm39) Y163* probably null Het
Dimt1 T C 13: 107,089,958 (GRCm39) V227A possibly damaging Het
Dnah6 A T 6: 73,077,095 (GRCm39) M2338K probably benign Het
Enthd1 T C 15: 80,336,586 (GRCm39) D616G probably damaging Het
Fignl2 T C 15: 100,951,997 (GRCm39) E95G probably damaging Het
Foxn1 A G 11: 78,249,692 (GRCm39) M611T probably benign Het
Foxs1 T C 2: 152,774,559 (GRCm39) S165G probably benign Het
Fzd3 G T 14: 65,472,956 (GRCm39) Q271K probably benign Het
Hadhb A T 5: 30,371,713 (GRCm39) I55F probably damaging Het
Hipk3 G A 2: 104,264,090 (GRCm39) Q824* probably null Het
Hps1 G A 19: 42,755,624 (GRCm39) R201W probably damaging Het
Kif21b T C 1: 136,099,423 (GRCm39) S1477P probably damaging Het
Kif26a A T 12: 112,123,680 (GRCm39) probably null Het
Krt90 T C 15: 101,469,026 (GRCm39) E172G possibly damaging Het
Lama4 T G 10: 38,951,446 (GRCm39) F1064V probably damaging Het
Leng9 A G 7: 4,151,902 (GRCm39) V258A probably benign Het
Lgi2 A C 5: 52,703,980 (GRCm39) V217G probably benign Het
Lpgat1 T C 1: 191,495,741 (GRCm39) I310T possibly damaging Het
Ltbp3 A G 19: 5,796,995 (GRCm39) Y374C probably damaging Het
Magi2 C A 5: 20,814,324 (GRCm39) T1075K probably damaging Het
Man2c1 T C 9: 57,042,793 (GRCm39) I221T probably benign Het
Mydgf A G 17: 56,486,415 (GRCm39) M72T possibly damaging Het
Myo1b T C 1: 51,815,474 (GRCm39) N624S probably damaging Het
Myo5c T A 9: 75,203,299 (GRCm39) M1465K probably damaging Het
Nek4 A T 14: 30,709,094 (GRCm39) D716V probably damaging Het
Nfxl1 T A 5: 72,686,380 (GRCm39) Q607L probably benign Het
Nlrp9c A T 7: 26,083,862 (GRCm39) D572E probably benign Het
Nop14 G T 5: 34,807,757 (GRCm39) Q402K possibly damaging Het
Npy5r C G 8: 67,134,052 (GRCm39) C247S probably damaging Het
Nrap T A 19: 56,378,255 (GRCm39) I19F probably damaging Het
Or4c102 A G 2: 88,422,352 (GRCm39) D68G probably damaging Het
Or51t4 T A 7: 102,597,721 (GRCm39) N16K probably damaging Het
Or6z3 T G 7: 6,463,744 (GRCm39) S79A probably damaging Het
Pcdh9 A T 14: 94,124,405 (GRCm39) Y588* probably null Het
Ppp1r12a A G 10: 108,096,728 (GRCm39) E183G probably damaging Het
Ppp2r2b T A 18: 42,821,375 (GRCm39) H261L probably benign Het
Ptch1 G T 13: 63,687,656 (GRCm39) T374K possibly damaging Het
Ptpn13 A T 5: 103,713,103 (GRCm39) N1742I possibly damaging Het
Rab33a C T X: 47,608,521 (GRCm39) S15L probably benign Het
Ralb T C 1: 119,405,744 (GRCm39) Y75C probably damaging Het
Rassf7 T A 7: 140,796,645 (GRCm39) V2D probably damaging Het
Rbm10 A G X: 20,512,230 (GRCm39) N397S probably benign Het
Rbm15 T C 3: 107,238,197 (GRCm39) T734A probably benign Het
Rbm8a G T 3: 96,539,046 (GRCm39) probably benign Het
Rock2 T C 12: 17,022,986 (GRCm39) I1095T probably benign Het
Rxfp3 T A 15: 11,036,389 (GRCm39) T328S probably damaging Het
Sec31a T A 5: 100,534,054 (GRCm39) K505N possibly damaging Het
Selenof A G 3: 144,302,642 (GRCm39) *122W probably null Het
Sh3pxd2b T C 11: 32,331,441 (GRCm39) M55T possibly damaging Het
Slc15a2 T C 16: 36,574,843 (GRCm39) D522G probably benign Het
Slc2a1 T C 4: 118,993,503 (GRCm39) F447L probably damaging Het
Slc45a2 T A 15: 11,022,214 (GRCm39) C319S probably null Het
Smad4 T C 18: 73,773,333 (GRCm39) D551G probably benign Het
Smarcc2 A G 10: 128,318,662 (GRCm39) Y648C probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Stab2 A T 10: 86,721,582 (GRCm39) probably null Het
Tanc1 A G 2: 59,615,731 (GRCm39) D246G probably damaging Het
Tekt3 T G 11: 62,978,024 (GRCm39) probably null Het
Them5 G A 3: 94,253,567 (GRCm39) probably null Het
Tlr4 T A 4: 66,757,717 (GRCm39) F170Y probably damaging Het
Tmem214 T G 5: 31,028,907 (GRCm39) Y165* probably null Het
Tmem94 T C 11: 115,686,971 (GRCm39) probably null Het
Tom1l1 A G 11: 90,547,177 (GRCm39) L301S possibly damaging Het
Trpm3 A G 19: 22,960,076 (GRCm39) E1237G probably damaging Het
Ube2d1 C A 10: 71,092,523 (GRCm39) C107F probably damaging Het
Ugt3a1 C T 15: 9,306,330 (GRCm39) R160* probably null Het
Vcan G A 13: 89,853,782 (GRCm39) P393S probably damaging Het
Virma T C 4: 11,544,954 (GRCm39) F1638L probably damaging Het
Vmn1r31 G A 6: 58,449,043 (GRCm39) T274I probably damaging Het
Xylt2 C T 11: 94,559,035 (GRCm39) S445N probably damaging Het
Zfp457 A G 13: 67,444,375 (GRCm39) F43L possibly damaging Het
Zfp879 T A 11: 50,723,473 (GRCm39) M455L probably benign Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0616:Dock4 UTSW 12 40,754,414 (GRCm39) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1682:Dock4 UTSW 12 40,775,779 (GRCm39) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R1986:Dock4 UTSW 12 40,780,062 (GRCm39) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,838,243 (GRCm39) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,775,676 (GRCm39) missense probably benign
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,883,118 (GRCm39) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,752,950 (GRCm39) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8873:Dock4 UTSW 12 40,726,767 (GRCm39) nonsense probably null
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCAATCACAGTTGCCTTGCTCCC -3'
(R):5'- AGCATCTACTGTCTCAAAGCCCCTC -3'

Sequencing Primer
(F):5'- CTGGGTGACTGTTTCACAAGAAC -3'
(R):5'- GCTTGAATCAATAAGGCACAATGC -3'
Posted On 2014-04-24