Incidental Mutation 'R1617:Col5a1'
ID174326
Institutional Source Beutler Lab
Gene Symbol Col5a1
Ensembl Gene ENSMUSG00000026837
Gene Namecollagen, type V, alpha 1
Synonyms
MMRRC Submission 039654-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1617 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location27886425-28039514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27952381 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 423 (S423P)
Ref Sequence ENSEMBL: ENSMUSP00000028280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028280]
Predicted Effect unknown
Transcript: ENSMUST00000028280
AA Change: S423P
SMART Domains Protein: ENSMUSP00000028280
Gene: ENSMUSG00000026837
AA Change: S423P

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
TSPN 39 230 5.7e-73 SMART
LamG 98 229 6.86e-3 SMART
low complexity region 259 288 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 374 387 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
internal_repeat_7 443 457 9.97e-7 PROSPERO
Pfam:Collagen 467 519 4e-10 PFAM
Pfam:Collagen 557 619 6.5e-9 PFAM
internal_repeat_2 622 642 1.83e-11 PROSPERO
low complexity region 643 698 N/A INTRINSIC
low complexity region 712 757 N/A INTRINSIC
low complexity region 760 793 N/A INTRINSIC
internal_repeat_5 794 817 3.78e-8 PROSPERO
internal_repeat_7 798 812 9.97e-7 PROSPERO
internal_repeat_8 802 821 8.84e-6 PROSPERO
low complexity region 826 862 N/A INTRINSIC
internal_repeat_3 865 889 2.79e-10 PROSPERO
internal_repeat_5 869 892 3.78e-8 PROSPERO
low complexity region 895 925 N/A INTRINSIC
internal_repeat_2 928 948 1.83e-11 PROSPERO
internal_repeat_4 928 948 1.27e-8 PROSPERO
low complexity region 949 979 N/A INTRINSIC
low complexity region 984 1033 N/A INTRINSIC
internal_repeat_4 1039 1062 1.27e-8 PROSPERO
internal_repeat_1 1039 1063 5.12e-15 PROSPERO
internal_repeat_3 1048 1072 2.79e-10 PROSPERO
internal_repeat_6 1049 1072 1.13e-7 PROSPERO
low complexity region 1075 1117 N/A INTRINSIC
low complexity region 1134 1165 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
internal_repeat_8 1195 1214 8.84e-6 PROSPERO
low complexity region 1215 1243 N/A INTRINSIC
low complexity region 1249 1282 N/A INTRINSIC
low complexity region 1285 1421 N/A INTRINSIC
internal_repeat_1 1423 1447 5.12e-15 PROSPERO
Pfam:Collagen 1460 1529 8.4e-9 PFAM
Pfam:Collagen 1513 1575 1.2e-9 PFAM
COLFI 1608 1837 3.33e-153 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. The encoded procollagen protein occurs commonly as the heterotrimer pro-alpha1(V)-pro-alpha1(V)-pro-alpha2(V). Mutations in this gene are associated with Ehlers-Danlos syndrome, types I and II. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10-11 due to cardiovascular insufficiency and lack of collagen fibril formation. Heterozygotes exhibit poorly organized and less dense fibers in the dermis and reduced skin tensile strength and are a model for Ehlers-Danlos Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,937 I91K probably damaging Het
Adamts16 T A 13: 70,798,035 M254L probably benign Het
Adgre5 T C 8: 83,730,177 I192V possibly damaging Het
Akr1c21 G A 13: 4,576,352 probably null Het
Amz2 A G 11: 109,434,024 T245A probably benign Het
Aqp7 A C 4: 41,036,109 M43R probably null Het
Arid3c G A 4: 41,725,103 P315S probably damaging Het
Birc2 A T 9: 7,826,951 Y345N possibly damaging Het
Blnk T C 19: 40,962,363 T115A probably benign Het
Corin A T 5: 72,503,952 F66Y possibly damaging Het
Cpd A T 11: 76,846,669 W100R probably damaging Het
Cpsf1 A T 15: 76,602,370 Y296* probably null Het
Cyp2d34 T C 15: 82,620,845 T5A probably benign Het
Dhrs7c G T 11: 67,815,077 V219L possibly damaging Het
Dnah3 T C 7: 120,089,946 M82V probably benign Het
Dnah9 A G 11: 65,895,921 S3629P probably damaging Het
Fam160a2 A G 7: 105,385,062 L454P probably damaging Het
Fbrs T C 7: 127,487,711 L33P probably damaging Het
Galnt11 T A 5: 25,258,893 S388T probably damaging Het
Glmp A G 3: 88,328,119 probably benign Het
Gm13178 T G 4: 144,715,391 T97P probably damaging Het
Gm13212 A T 4: 145,624,307 probably benign Het
Gm9268 A G 7: 43,024,079 E187G probably benign Het
Gm9894 A G 13: 67,772,726 noncoding transcript Het
Grik3 A G 4: 125,691,192 M618V probably benign Het
Hmcn1 T C 1: 150,745,027 D1144G probably damaging Het
Hnrnpa2b1 T C 6: 51,466,398 K161R possibly damaging Het
Kmt2c T C 5: 25,375,927 I523V probably benign Het
Lmln C T 16: 33,117,130 P622S probably damaging Het
Lmtk2 A G 5: 144,173,862 T467A probably damaging Het
Map1s T A 8: 70,913,451 N333K probably damaging Het
Mgat4d C A 8: 83,365,711 A242D probably damaging Het
Muc5b T A 7: 141,863,524 Y3402* probably null Het
Myo3b G T 2: 70,281,218 A922S probably benign Het
Nphs1 T C 7: 30,482,531 V1183A probably benign Het
Nup160 T A 2: 90,679,499 C31S probably benign Het
Olfr1061 A T 2: 86,413,691 Y120* probably null Het
Olfr48 T C 2: 89,844,254 T240A probably benign Het
Pcdhb5 T G 18: 37,321,402 Y278* probably null Het
Pkhd1 T A 1: 20,198,050 E3368V possibly damaging Het
Pla2g6 A G 15: 79,289,141 M676T probably benign Het
Plcb1 A T 2: 135,337,441 N590Y probably damaging Het
Prr12 G A 7: 45,049,594 probably benign Het
Psat1 A G 19: 15,924,302 probably null Het
Ptpn9 T G 9: 57,027,408 I152S possibly damaging Het
Ric8b T A 10: 84,947,611 F111Y probably damaging Het
Slc44a3 G A 3: 121,461,265 A568V probably benign Het
Smarcd3 T G 5: 24,595,194 R213S probably damaging Het
Snx13 T C 12: 35,086,896 Y119H probably damaging Het
Socs2 C A 10: 95,413,081 E57* probably null Het
Spred1 C T 2: 117,175,347 P197S probably benign Het
Srek1 G T 13: 103,743,604 P482Q unknown Het
Tapbp A G 17: 33,920,431 T134A probably benign Het
Tarbp1 T C 8: 126,444,268 I998V possibly damaging Het
Tbcel G T 9: 42,461,293 probably benign Het
Tec A G 5: 72,782,105 F189S probably damaging Het
Tmprss11g A T 5: 86,499,563 Y39N probably damaging Het
Tmtc1 A G 6: 148,355,404 probably benign Het
Trpa1 A G 1: 14,873,675 I1070T probably damaging Het
Trpm2 T A 10: 77,935,875 probably null Het
Ttc21b G T 2: 66,226,035 T669K probably benign Het
Ttll4 G A 1: 74,679,401 R137H probably benign Het
Ubqln3 G T 7: 104,142,860 L8I possibly damaging Het
Ung C A 5: 114,131,354 N42K probably benign Het
Upp1 T C 11: 9,134,865 S195P probably damaging Het
Urb1 T C 16: 90,760,452 E1762G possibly damaging Het
Utp11 T C 4: 124,686,111 K35E probably damaging Het
Vav3 A T 3: 109,510,978 K305I probably damaging Het
Vmn1r197 A G 13: 22,328,328 I140V possibly damaging Het
Zfc3h1 A G 10: 115,390,922 T295A probably benign Het
Zfp46 T C 4: 136,290,512 L219P probably damaging Het
Zfp493 G A 13: 67,783,880 V33M probably damaging Het
Zfp92 T C X: 73,419,860 probably benign Het
Other mutations in Col5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Col5a1 APN 2 27971444 splice site probably benign
IGL01340:Col5a1 APN 2 27960451 missense unknown
IGL01938:Col5a1 APN 2 27996873 missense unknown
IGL02167:Col5a1 APN 2 28018556 missense probably benign
IGL02670:Col5a1 APN 2 27974715 missense unknown
IGL02672:Col5a1 APN 2 27974715 missense unknown
IGL02673:Col5a1 APN 2 27974715 missense unknown
IGL02832:Col5a1 APN 2 27952340 missense unknown
IGL03065:Col5a1 APN 2 28032745 missense possibly damaging 0.61
IGL03196:Col5a1 APN 2 27975598 missense unknown
PIT4131001:Col5a1 UTSW 2 28024653 missense probably benign 0.01
PIT4495001:Col5a1 UTSW 2 28024776 missense unknown
R0136:Col5a1 UTSW 2 28024831 missense probably damaging 1.00
R0485:Col5a1 UTSW 2 27990097 splice site probably benign
R0626:Col5a1 UTSW 2 27928243 nonsense probably null
R0666:Col5a1 UTSW 2 28032685 missense probably damaging 1.00
R1268:Col5a1 UTSW 2 28002489 missense unknown
R1302:Col5a1 UTSW 2 28005236 missense probably damaging 1.00
R1416:Col5a1 UTSW 2 27922064 missense unknown
R1466:Col5a1 UTSW 2 28003846 splice site probably benign
R1650:Col5a1 UTSW 2 27922159 missense unknown
R1663:Col5a1 UTSW 2 27951476 missense unknown
R1901:Col5a1 UTSW 2 27960444 missense unknown
R1970:Col5a1 UTSW 2 27986754 missense unknown
R2377:Col5a1 UTSW 2 27928177 missense unknown
R2396:Col5a1 UTSW 2 27986729 missense unknown
R4297:Col5a1 UTSW 2 28017204 critical splice donor site probably null
R4385:Col5a1 UTSW 2 28024779 missense probably damaging 1.00
R4803:Col5a1 UTSW 2 28011341 missense unknown
R4835:Col5a1 UTSW 2 28025644 missense probably damaging 1.00
R4935:Col5a1 UTSW 2 28024742 missense probably damaging 1.00
R4994:Col5a1 UTSW 2 28032739 missense possibly damaging 0.90
R4997:Col5a1 UTSW 2 28032782 nonsense probably null
R5061:Col5a1 UTSW 2 27952378 missense unknown
R5088:Col5a1 UTSW 2 28018602 nonsense probably null
R5089:Col5a1 UTSW 2 28018602 nonsense probably null
R5090:Col5a1 UTSW 2 28018602 nonsense probably null
R5114:Col5a1 UTSW 2 28025652 missense probably damaging 1.00
R5409:Col5a1 UTSW 2 27960445 missense unknown
R5649:Col5a1 UTSW 2 27951456 missense unknown
R5699:Col5a1 UTSW 2 27997599 missense unknown
R5910:Col5a1 UTSW 2 28036888 missense possibly damaging 0.89
R6053:Col5a1 UTSW 2 28014377 unclassified probably benign
R6210:Col5a1 UTSW 2 28032621 missense probably benign 0.04
R6363:Col5a1 UTSW 2 27928195 missense unknown
R6478:Col5a1 UTSW 2 27952436 missense unknown
R6600:Col5a1 UTSW 2 27997571 missense unknown
R7047:Col5a1 UTSW 2 27928084 missense unknown
R7061:Col5a1 UTSW 2 28025678 nonsense probably null
R7131:Col5a1 UTSW 2 27929486 missense unknown
R7202:Col5a1 UTSW 2 27952378 missense unknown
R7270:Col5a1 UTSW 2 27997585 missense unknown
R7385:Col5a1 UTSW 2 28024750 missense unknown
R7492:Col5a1 UTSW 2 27969800 critical splice donor site probably null
R7570:Col5a1 UTSW 2 27951383 missense unknown
R7627:Col5a1 UTSW 2 27950653 nonsense probably null
R8003:Col5a1 UTSW 2 27958328 intron probably benign
R8011:Col5a1 UTSW 2 27980521 splice site probably benign
R8073:Col5a1 UTSW 2 27962129 missense possibly damaging 0.85
R8217:Col5a1 UTSW 2 27922123 missense unknown
Z1176:Col5a1 UTSW 2 28002517 missense unknown
Predicted Primers PCR Primer
(F):5'- CCACTGACAGCTCTATGCAGGAAG -3'
(R):5'- GCAGTGAGGCACAGATGACCATAAC -3'

Sequencing Primer
(F):5'- CTATGCAGGAAGTGCTAGGCTC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2014-04-24