Incidental Mutation 'R1617:Myo3b'
ID174329
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
MMRRC Submission 039654-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1617 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70281218 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 922 (A922S)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: A922S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: A922S

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: A894S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: A894S

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.0679 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,937 I91K probably damaging Het
Adamts16 T A 13: 70,798,035 M254L probably benign Het
Adgre5 T C 8: 83,730,177 I192V possibly damaging Het
Akr1c21 G A 13: 4,576,352 probably null Het
Amz2 A G 11: 109,434,024 T245A probably benign Het
Aqp7 A C 4: 41,036,109 M43R probably null Het
Arid3c G A 4: 41,725,103 P315S probably damaging Het
Birc2 A T 9: 7,826,951 Y345N possibly damaging Het
Blnk T C 19: 40,962,363 T115A probably benign Het
Col5a1 T C 2: 27,952,381 S423P unknown Het
Corin A T 5: 72,503,952 F66Y possibly damaging Het
Cpd A T 11: 76,846,669 W100R probably damaging Het
Cpsf1 A T 15: 76,602,370 Y296* probably null Het
Cyp2d34 T C 15: 82,620,845 T5A probably benign Het
Dhrs7c G T 11: 67,815,077 V219L possibly damaging Het
Dnah3 T C 7: 120,089,946 M82V probably benign Het
Dnah9 A G 11: 65,895,921 S3629P probably damaging Het
Fam160a2 A G 7: 105,385,062 L454P probably damaging Het
Fbrs T C 7: 127,487,711 L33P probably damaging Het
Galnt11 T A 5: 25,258,893 S388T probably damaging Het
Glmp A G 3: 88,328,119 probably benign Het
Gm13178 T G 4: 144,715,391 T97P probably damaging Het
Gm13212 A T 4: 145,624,307 probably benign Het
Gm9268 A G 7: 43,024,079 E187G probably benign Het
Gm9894 A G 13: 67,772,726 noncoding transcript Het
Grik3 A G 4: 125,691,192 M618V probably benign Het
Hmcn1 T C 1: 150,745,027 D1144G probably damaging Het
Hnrnpa2b1 T C 6: 51,466,398 K161R possibly damaging Het
Kmt2c T C 5: 25,375,927 I523V probably benign Het
Lmln C T 16: 33,117,130 P622S probably damaging Het
Lmtk2 A G 5: 144,173,862 T467A probably damaging Het
Map1s T A 8: 70,913,451 N333K probably damaging Het
Mgat4d C A 8: 83,365,711 A242D probably damaging Het
Muc5b T A 7: 141,863,524 Y3402* probably null Het
Nphs1 T C 7: 30,482,531 V1183A probably benign Het
Nup160 T A 2: 90,679,499 C31S probably benign Het
Olfr1061 A T 2: 86,413,691 Y120* probably null Het
Olfr48 T C 2: 89,844,254 T240A probably benign Het
Pcdhb5 T G 18: 37,321,402 Y278* probably null Het
Pkhd1 T A 1: 20,198,050 E3368V possibly damaging Het
Pla2g6 A G 15: 79,289,141 M676T probably benign Het
Plcb1 A T 2: 135,337,441 N590Y probably damaging Het
Prr12 G A 7: 45,049,594 probably benign Het
Psat1 A G 19: 15,924,302 probably null Het
Ptpn9 T G 9: 57,027,408 I152S possibly damaging Het
Ric8b T A 10: 84,947,611 F111Y probably damaging Het
Slc44a3 G A 3: 121,461,265 A568V probably benign Het
Smarcd3 T G 5: 24,595,194 R213S probably damaging Het
Snx13 T C 12: 35,086,896 Y119H probably damaging Het
Socs2 C A 10: 95,413,081 E57* probably null Het
Spred1 C T 2: 117,175,347 P197S probably benign Het
Srek1 G T 13: 103,743,604 P482Q unknown Het
Tapbp A G 17: 33,920,431 T134A probably benign Het
Tarbp1 T C 8: 126,444,268 I998V possibly damaging Het
Tbcel G T 9: 42,461,293 probably benign Het
Tec A G 5: 72,782,105 F189S probably damaging Het
Tmprss11g A T 5: 86,499,563 Y39N probably damaging Het
Tmtc1 A G 6: 148,355,404 probably benign Het
Trpa1 A G 1: 14,873,675 I1070T probably damaging Het
Trpm2 T A 10: 77,935,875 probably null Het
Ttc21b G T 2: 66,226,035 T669K probably benign Het
Ttll4 G A 1: 74,679,401 R137H probably benign Het
Ubqln3 G T 7: 104,142,860 L8I possibly damaging Het
Ung C A 5: 114,131,354 N42K probably benign Het
Upp1 T C 11: 9,134,865 S195P probably damaging Het
Urb1 T C 16: 90,760,452 E1762G possibly damaging Het
Utp11 T C 4: 124,686,111 K35E probably damaging Het
Vav3 A T 3: 109,510,978 K305I probably damaging Het
Vmn1r197 A G 13: 22,328,328 I140V possibly damaging Het
Zfc3h1 A G 10: 115,390,922 T295A probably benign Het
Zfp46 T C 4: 136,290,512 L219P probably damaging Het
Zfp493 G A 13: 67,783,880 V33M probably damaging Het
Zfp92 T C X: 73,419,860 probably benign Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAGGCATGGTCACCTTGTGTCAG -3'
(R):5'- TCGTCACCCTCTACGTTAGGGTTG -3'

Sequencing Primer
(F):5'- gtcagttctctccttccacc -3'
(R):5'- TGCTGACTATCAGGATTGCAAG -3'
Posted On2014-04-24