Incidental Mutation 'R1617:Olfr1061'
ID174330
Institutional Source Beutler Lab
Gene Symbol Olfr1061
Ensembl Gene ENSMUSG00000075185
Gene Nameolfactory receptor 1061
SynonymsMOR188-9, MOR188-1, MOR188-7, Olfr1515, GA_x6K02T2Q125-47883395-47882454, MOR188-1
MMRRC Submission 039654-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1617 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86413109-86414050 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86413691 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 120 (Y120*)
Ref Sequence ENSEMBL: ENSMUSP00000097474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099889]
Predicted Effect probably null
Transcript: ENSMUST00000099889
AA Change: Y120*
SMART Domains Protein: ENSMUSP00000097474
Gene: ENSMUSG00000075185
AA Change: Y120*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-51 PFAM
Pfam:7tm_1 41 291 2.2e-17 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,937 I91K probably damaging Het
Adamts16 T A 13: 70,798,035 M254L probably benign Het
Adgre5 T C 8: 83,730,177 I192V possibly damaging Het
Akr1c21 G A 13: 4,576,352 probably null Het
Amz2 A G 11: 109,434,024 T245A probably benign Het
Aqp7 A C 4: 41,036,109 M43R probably null Het
Arid3c G A 4: 41,725,103 P315S probably damaging Het
Birc2 A T 9: 7,826,951 Y345N possibly damaging Het
Blnk T C 19: 40,962,363 T115A probably benign Het
Col5a1 T C 2: 27,952,381 S423P unknown Het
Corin A T 5: 72,503,952 F66Y possibly damaging Het
Cpd A T 11: 76,846,669 W100R probably damaging Het
Cpsf1 A T 15: 76,602,370 Y296* probably null Het
Cyp2d34 T C 15: 82,620,845 T5A probably benign Het
Dhrs7c G T 11: 67,815,077 V219L possibly damaging Het
Dnah3 T C 7: 120,089,946 M82V probably benign Het
Dnah9 A G 11: 65,895,921 S3629P probably damaging Het
Fam160a2 A G 7: 105,385,062 L454P probably damaging Het
Fbrs T C 7: 127,487,711 L33P probably damaging Het
Galnt11 T A 5: 25,258,893 S388T probably damaging Het
Glmp A G 3: 88,328,119 probably benign Het
Gm13178 T G 4: 144,715,391 T97P probably damaging Het
Gm13212 A T 4: 145,624,307 probably benign Het
Gm9268 A G 7: 43,024,079 E187G probably benign Het
Gm9894 A G 13: 67,772,726 noncoding transcript Het
Grik3 A G 4: 125,691,192 M618V probably benign Het
Hmcn1 T C 1: 150,745,027 D1144G probably damaging Het
Hnrnpa2b1 T C 6: 51,466,398 K161R possibly damaging Het
Kmt2c T C 5: 25,375,927 I523V probably benign Het
Lmln C T 16: 33,117,130 P622S probably damaging Het
Lmtk2 A G 5: 144,173,862 T467A probably damaging Het
Map1s T A 8: 70,913,451 N333K probably damaging Het
Mgat4d C A 8: 83,365,711 A242D probably damaging Het
Muc5b T A 7: 141,863,524 Y3402* probably null Het
Myo3b G T 2: 70,281,218 A922S probably benign Het
Nphs1 T C 7: 30,482,531 V1183A probably benign Het
Nup160 T A 2: 90,679,499 C31S probably benign Het
Olfr48 T C 2: 89,844,254 T240A probably benign Het
Pcdhb5 T G 18: 37,321,402 Y278* probably null Het
Pkhd1 T A 1: 20,198,050 E3368V possibly damaging Het
Pla2g6 A G 15: 79,289,141 M676T probably benign Het
Plcb1 A T 2: 135,337,441 N590Y probably damaging Het
Prr12 G A 7: 45,049,594 probably benign Het
Psat1 A G 19: 15,924,302 probably null Het
Ptpn9 T G 9: 57,027,408 I152S possibly damaging Het
Ric8b T A 10: 84,947,611 F111Y probably damaging Het
Slc44a3 G A 3: 121,461,265 A568V probably benign Het
Smarcd3 T G 5: 24,595,194 R213S probably damaging Het
Snx13 T C 12: 35,086,896 Y119H probably damaging Het
Socs2 C A 10: 95,413,081 E57* probably null Het
Spred1 C T 2: 117,175,347 P197S probably benign Het
Srek1 G T 13: 103,743,604 P482Q unknown Het
Tapbp A G 17: 33,920,431 T134A probably benign Het
Tarbp1 T C 8: 126,444,268 I998V possibly damaging Het
Tbcel G T 9: 42,461,293 probably benign Het
Tec A G 5: 72,782,105 F189S probably damaging Het
Tmprss11g A T 5: 86,499,563 Y39N probably damaging Het
Tmtc1 A G 6: 148,355,404 probably benign Het
Trpa1 A G 1: 14,873,675 I1070T probably damaging Het
Trpm2 T A 10: 77,935,875 probably null Het
Ttc21b G T 2: 66,226,035 T669K probably benign Het
Ttll4 G A 1: 74,679,401 R137H probably benign Het
Ubqln3 G T 7: 104,142,860 L8I possibly damaging Het
Ung C A 5: 114,131,354 N42K probably benign Het
Upp1 T C 11: 9,134,865 S195P probably damaging Het
Urb1 T C 16: 90,760,452 E1762G possibly damaging Het
Utp11 T C 4: 124,686,111 K35E probably damaging Het
Vav3 A T 3: 109,510,978 K305I probably damaging Het
Vmn1r197 A G 13: 22,328,328 I140V possibly damaging Het
Zfc3h1 A G 10: 115,390,922 T295A probably benign Het
Zfp46 T C 4: 136,290,512 L219P probably damaging Het
Zfp493 G A 13: 67,783,880 V33M probably damaging Het
Zfp92 T C X: 73,419,860 probably benign Het
Other mutations in Olfr1061
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Olfr1061 APN 2 86413800 missense probably benign 0.35
IGL01721:Olfr1061 APN 2 86413333 missense probably damaging 1.00
IGL02696:Olfr1061 APN 2 86413615 missense probably benign 0.03
R0366:Olfr1061 UTSW 2 86414025 missense possibly damaging 0.71
R0607:Olfr1061 UTSW 2 86413170 missense probably damaging 1.00
R1013:Olfr1061 UTSW 2 86413975 missense possibly damaging 0.61
R1017:Olfr1061 UTSW 2 86413511 missense probably damaging 1.00
R1690:Olfr1061 UTSW 2 86413954 missense probably benign 0.03
R4126:Olfr1061 UTSW 2 86413224 missense probably damaging 0.99
R5053:Olfr1061 UTSW 2 86413338 missense probably damaging 1.00
R5443:Olfr1061 UTSW 2 86413593 missense possibly damaging 0.54
R6195:Olfr1061 UTSW 2 86413207 missense probably damaging 0.98
R6233:Olfr1061 UTSW 2 86413207 missense probably damaging 0.98
R6468:Olfr1061 UTSW 2 86414037 missense probably damaging 0.99
R7188:Olfr1061 UTSW 2 86413351 nonsense probably null
R7300:Olfr1061 UTSW 2 86413986 missense probably null 0.27
R7374:Olfr1061 UTSW 2 86413852 missense probably benign 0.39
R7392:Olfr1061 UTSW 2 86413152 missense probably benign
R7494:Olfr1061 UTSW 2 86413248 missense probably benign 0.24
X0023:Olfr1061 UTSW 2 86413959 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CGTAGAGAAAGCCTTCCATTTGCCC -3'
(R):5'- AGACACCTCGCTACTACTGACCTTG -3'

Sequencing Primer
(F):5'- GCCCTCAGCAGAGTTAATCCTTAG -3'
(R):5'- ACTGACCTTGGTTATTCAACAGC -3'
Posted On2014-04-24