Incidental Mutation 'R1617:Hnrnpa2b1'
ID174353
Institutional Source Beutler Lab
Gene Symbol Hnrnpa2b1
Ensembl Gene ENSMUSG00000004980
Gene Nameheterogeneous nuclear ribonucleoprotein A2/B1
Synonyms9130414A06Rik, Hnrpa2, Hnrpa2b1
MMRRC Submission 039654-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R1617 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location51460932-51469894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51466398 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 161 (K161R)
Ref Sequence ENSEMBL: ENSMUSP00000145374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031862] [ENSMUST00000069949] [ENSMUST00000090002] [ENSMUST00000094623] [ENSMUST00000114445] [ENSMUST00000114446] [ENSMUST00000114459] [ENSMUST00000141711] [ENSMUST00000203220] [ENSMUST00000203954] [ENSMUST00000204158] [ENSMUST00000204188]
Predicted Effect probably benign
Transcript: ENSMUST00000031862
SMART Domains Protein: ENSMUSP00000031862
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069949
AA Change: K161R

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067491
Gene: ENSMUSG00000004980
AA Change: K161R

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 5.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090002
AA Change: K161R

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087453
Gene: ENSMUSG00000004980
AA Change: K161R

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094623
SMART Domains Protein: ENSMUSP00000110091
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114445
SMART Domains Protein: ENSMUSP00000110088
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
Pfam:Chromo 30 60 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114446
SMART Domains Protein: ENSMUSP00000110089
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114459
AA Change: K173R

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110103
Gene: ENSMUSG00000004980
AA Change: K173R

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141711
SMART Domains Protein: ENSMUSP00000121370
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 109 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156463
Predicted Effect possibly damaging
Transcript: ENSMUST00000203220
AA Change: K161R

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145374
Gene: ENSMUSG00000004980
AA Change: K161R

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203253
AA Change: K71R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203655
Predicted Effect probably benign
Transcript: ENSMUST00000203954
AA Change: K173R

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145028
Gene: ENSMUSG00000004980
AA Change: K173R

DomainStartEndE-ValueType
RRM 22 94 1.51e-23 SMART
RRM 113 185 7.64e-20 SMART
low complexity region 198 307 N/A INTRINSIC
low complexity region 322 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204090
Predicted Effect probably benign
Transcript: ENSMUST00000204158
AA Change: K161R

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145383
Gene: ENSMUSG00000004980
AA Change: K161R

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204188
AA Change: K161R

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145245
Gene: ENSMUSG00000004980
AA Change: K161R

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205204
Meta Mutation Damage Score 0.0959 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. This gene has been described to generate two alternatively spliced transcript variants which encode different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,937 I91K probably damaging Het
Adamts16 T A 13: 70,798,035 M254L probably benign Het
Adgre5 T C 8: 83,730,177 I192V possibly damaging Het
Akr1c21 G A 13: 4,576,352 probably null Het
Amz2 A G 11: 109,434,024 T245A probably benign Het
Aqp7 A C 4: 41,036,109 M43R probably null Het
Arid3c G A 4: 41,725,103 P315S probably damaging Het
Birc2 A T 9: 7,826,951 Y345N possibly damaging Het
Blnk T C 19: 40,962,363 T115A probably benign Het
Col5a1 T C 2: 27,952,381 S423P unknown Het
Corin A T 5: 72,503,952 F66Y possibly damaging Het
Cpd A T 11: 76,846,669 W100R probably damaging Het
Cpsf1 A T 15: 76,602,370 Y296* probably null Het
Cyp2d34 T C 15: 82,620,845 T5A probably benign Het
Dhrs7c G T 11: 67,815,077 V219L possibly damaging Het
Dnah3 T C 7: 120,089,946 M82V probably benign Het
Dnah9 A G 11: 65,895,921 S3629P probably damaging Het
Fam160a2 A G 7: 105,385,062 L454P probably damaging Het
Fbrs T C 7: 127,487,711 L33P probably damaging Het
Galnt11 T A 5: 25,258,893 S388T probably damaging Het
Glmp A G 3: 88,328,119 probably benign Het
Gm13178 T G 4: 144,715,391 T97P probably damaging Het
Gm13212 A T 4: 145,624,307 probably benign Het
Gm9268 A G 7: 43,024,079 E187G probably benign Het
Gm9894 A G 13: 67,772,726 noncoding transcript Het
Grik3 A G 4: 125,691,192 M618V probably benign Het
Hmcn1 T C 1: 150,745,027 D1144G probably damaging Het
Kmt2c T C 5: 25,375,927 I523V probably benign Het
Lmln C T 16: 33,117,130 P622S probably damaging Het
Lmtk2 A G 5: 144,173,862 T467A probably damaging Het
Map1s T A 8: 70,913,451 N333K probably damaging Het
Mgat4d C A 8: 83,365,711 A242D probably damaging Het
Muc5b T A 7: 141,863,524 Y3402* probably null Het
Myo3b G T 2: 70,281,218 A922S probably benign Het
Nphs1 T C 7: 30,482,531 V1183A probably benign Het
Nup160 T A 2: 90,679,499 C31S probably benign Het
Olfr1061 A T 2: 86,413,691 Y120* probably null Het
Olfr48 T C 2: 89,844,254 T240A probably benign Het
Pcdhb5 T G 18: 37,321,402 Y278* probably null Het
Pkhd1 T A 1: 20,198,050 E3368V possibly damaging Het
Pla2g6 A G 15: 79,289,141 M676T probably benign Het
Plcb1 A T 2: 135,337,441 N590Y probably damaging Het
Prr12 G A 7: 45,049,594 probably benign Het
Psat1 A G 19: 15,924,302 probably null Het
Ptpn9 T G 9: 57,027,408 I152S possibly damaging Het
Ric8b T A 10: 84,947,611 F111Y probably damaging Het
Slc44a3 G A 3: 121,461,265 A568V probably benign Het
Smarcd3 T G 5: 24,595,194 R213S probably damaging Het
Snx13 T C 12: 35,086,896 Y119H probably damaging Het
Socs2 C A 10: 95,413,081 E57* probably null Het
Spred1 C T 2: 117,175,347 P197S probably benign Het
Srek1 G T 13: 103,743,604 P482Q unknown Het
Tapbp A G 17: 33,920,431 T134A probably benign Het
Tarbp1 T C 8: 126,444,268 I998V possibly damaging Het
Tbcel G T 9: 42,461,293 probably benign Het
Tec A G 5: 72,782,105 F189S probably damaging Het
Tmprss11g A T 5: 86,499,563 Y39N probably damaging Het
Tmtc1 A G 6: 148,355,404 probably benign Het
Trpa1 A G 1: 14,873,675 I1070T probably damaging Het
Trpm2 T A 10: 77,935,875 probably null Het
Ttc21b G T 2: 66,226,035 T669K probably benign Het
Ttll4 G A 1: 74,679,401 R137H probably benign Het
Ubqln3 G T 7: 104,142,860 L8I possibly damaging Het
Ung C A 5: 114,131,354 N42K probably benign Het
Upp1 T C 11: 9,134,865 S195P probably damaging Het
Urb1 T C 16: 90,760,452 E1762G possibly damaging Het
Utp11 T C 4: 124,686,111 K35E probably damaging Het
Vav3 A T 3: 109,510,978 K305I probably damaging Het
Vmn1r197 A G 13: 22,328,328 I140V possibly damaging Het
Zfc3h1 A G 10: 115,390,922 T295A probably benign Het
Zfp46 T C 4: 136,290,512 L219P probably damaging Het
Zfp493 G A 13: 67,783,880 V33M probably damaging Het
Zfp92 T C X: 73,419,860 probably benign Het
Other mutations in Hnrnpa2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Hnrnpa2b1 APN 6 51467013 missense probably damaging 1.00
PIT4142001:Hnrnpa2b1 UTSW 6 51464109 missense probably benign 0.10
R4694:Hnrnpa2b1 UTSW 6 51464183 missense probably damaging 1.00
R5422:Hnrnpa2b1 UTSW 6 51465228 missense probably benign 0.23
R5854:Hnrnpa2b1 UTSW 6 51466609 unclassified probably benign
R7666:Hnrnpa2b1 UTSW 6 51466937 missense possibly damaging 0.53
RF020:Hnrnpa2b1 UTSW 6 51466694 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTGGTCCTGGTCCAAAATTGC -3'
(R):5'- GCCCATGTGACTGTGAAGAAGCTG -3'

Sequencing Primer
(F):5'- GGTCCAAAATTGCCACCG -3'
(R):5'- ATAATTACCGATAGGCAGTCTGG -3'
Posted On2014-04-24