Incidental Mutation 'R1617:Ubqln3'
ID 174359
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 039654-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R1617 (G1)
Quality Score 180
Status Validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 103792067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 8 (L8I)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254]
AlphaFold Q8C5U9
Predicted Effect possibly damaging
Transcript: ENSMUST00000057254
AA Change: L8I

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: L8I

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,603,473 (GRCm39) I91K probably damaging Het
AAdacl4fm3 T G 4: 144,441,961 (GRCm39) T97P probably damaging Het
Adamts16 T A 13: 70,946,154 (GRCm39) M254L probably benign Het
Adgre5 T C 8: 84,456,806 (GRCm39) I192V possibly damaging Het
Akr1c21 G A 13: 4,626,351 (GRCm39) probably null Het
Amz2 A G 11: 109,324,850 (GRCm39) T245A probably benign Het
Aqp7 A C 4: 41,036,109 (GRCm39) M43R probably null Het
Arid3c G A 4: 41,725,103 (GRCm39) P315S probably damaging Het
Birc2 A T 9: 7,826,952 (GRCm39) Y345N possibly damaging Het
Blnk T C 19: 40,950,807 (GRCm39) T115A probably benign Het
Col5a1 T C 2: 27,842,393 (GRCm39) S423P unknown Het
Corin A T 5: 72,661,295 (GRCm39) F66Y possibly damaging Het
Cpd A T 11: 76,737,495 (GRCm39) W100R probably damaging Het
Cpsf1 A T 15: 76,486,570 (GRCm39) Y296* probably null Het
Cyp2d34 T C 15: 82,505,046 (GRCm39) T5A probably benign Het
Dhrs7c G T 11: 67,705,903 (GRCm39) V219L possibly damaging Het
Dnah3 T C 7: 119,689,169 (GRCm39) M82V probably benign Het
Dnah9 A G 11: 65,786,747 (GRCm39) S3629P probably damaging Het
Fbrs T C 7: 127,086,883 (GRCm39) L33P probably damaging Het
Fhip1b A G 7: 105,034,269 (GRCm39) L454P probably damaging Het
Galnt11 T A 5: 25,463,891 (GRCm39) S388T probably damaging Het
Glmp A G 3: 88,235,426 (GRCm39) probably benign Het
Gm9894 A G 13: 67,920,845 (GRCm39) noncoding transcript Het
Grik3 A G 4: 125,584,985 (GRCm39) M618V probably benign Het
Hmcn1 T C 1: 150,620,778 (GRCm39) D1144G probably damaging Het
Hnrnpa2b1 T C 6: 51,443,378 (GRCm39) K161R possibly damaging Het
Kmt2c T C 5: 25,580,925 (GRCm39) I523V probably benign Het
Lmln C T 16: 32,937,500 (GRCm39) P622S probably damaging Het
Lmtk2 A G 5: 144,110,680 (GRCm39) T467A probably damaging Het
Map1s T A 8: 71,366,095 (GRCm39) N333K probably damaging Het
Mgat4d C A 8: 84,092,340 (GRCm39) A242D probably damaging Het
Muc5b T A 7: 141,417,261 (GRCm39) Y3402* probably null Het
Myo3b G T 2: 70,111,562 (GRCm39) A922S probably benign Het
Nphs1 T C 7: 30,181,956 (GRCm39) V1183A probably benign Het
Nup160 T A 2: 90,509,843 (GRCm39) C31S probably benign Het
Or4c58 T C 2: 89,674,598 (GRCm39) T240A probably benign Het
Or8k25 A T 2: 86,244,035 (GRCm39) Y120* probably null Het
Pcdhb5 T G 18: 37,454,455 (GRCm39) Y278* probably null Het
Pkhd1 T A 1: 20,268,274 (GRCm39) E3368V possibly damaging Het
Pla2g6 A G 15: 79,173,341 (GRCm39) M676T probably benign Het
Plcb1 A T 2: 135,179,361 (GRCm39) N590Y probably damaging Het
Prr12 G A 7: 44,699,018 (GRCm39) probably benign Het
Psat1 A G 19: 15,901,666 (GRCm39) probably null Het
Ptpn9 T G 9: 56,934,692 (GRCm39) I152S possibly damaging Het
Ric8b T A 10: 84,783,475 (GRCm39) F111Y probably damaging Het
Slc44a3 G A 3: 121,254,914 (GRCm39) A568V probably benign Het
Smarcd3 T G 5: 24,800,192 (GRCm39) R213S probably damaging Het
Snx13 T C 12: 35,136,895 (GRCm39) Y119H probably damaging Het
Socs2 C A 10: 95,248,943 (GRCm39) E57* probably null Het
Spred1 C T 2: 117,005,828 (GRCm39) P197S probably benign Het
Srek1 G T 13: 103,880,112 (GRCm39) P482Q unknown Het
Tapbp A G 17: 34,139,405 (GRCm39) T134A probably benign Het
Tarbp1 T C 8: 127,171,007 (GRCm39) I998V possibly damaging Het
Tbcel G T 9: 42,372,589 (GRCm39) probably benign Het
Tec A G 5: 72,939,448 (GRCm39) F189S probably damaging Het
Tmprss11g A T 5: 86,647,422 (GRCm39) Y39N probably damaging Het
Tmtc1 A G 6: 148,256,902 (GRCm39) probably benign Het
Trpa1 A G 1: 14,943,899 (GRCm39) I1070T probably damaging Het
Trpm2 T A 10: 77,771,709 (GRCm39) probably null Het
Ttc21b G T 2: 66,056,379 (GRCm39) T669K probably benign Het
Ttll4 G A 1: 74,718,560 (GRCm39) R137H probably benign Het
Ung C A 5: 114,269,415 (GRCm39) N42K probably benign Het
Upp1 T C 11: 9,084,865 (GRCm39) S195P probably damaging Het
Urb1 T C 16: 90,557,340 (GRCm39) E1762G possibly damaging Het
Utp11 T C 4: 124,579,904 (GRCm39) K35E probably damaging Het
Vav3 A T 3: 109,418,294 (GRCm39) K305I probably damaging Het
Vmn1r197 A G 13: 22,512,498 (GRCm39) I140V possibly damaging Het
Vmn2r-ps158 A G 7: 42,673,503 (GRCm39) E187G probably benign Het
Zfc3h1 A G 10: 115,226,827 (GRCm39) T295A probably benign Het
Zfp268 A T 4: 145,350,877 (GRCm39) probably benign Het
Zfp46 T C 4: 136,017,823 (GRCm39) L219P probably damaging Het
Zfp493 G A 13: 67,931,999 (GRCm39) V33M probably damaging Het
Zfp92 T C X: 72,463,466 (GRCm39) probably benign Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACTCCACACTGTGCCAATGAGTC -3'
(R):5'- TTCCAAGTGACCTAGTGGTCCTCTC -3'

Sequencing Primer
(F):5'- GGATTTTTCCAGCAAAGATCAGGAC -3'
(R):5'- TCCAAGGCCCTCCTTATACT -3'
Posted On 2014-04-24