Incidental Mutation 'R1617:Ptpn9'
ID174370
Institutional Source Beutler Lab
Gene Symbol Ptpn9
Ensembl Gene ENSMUSG00000032290
Gene Nameprotein tyrosine phosphatase, non-receptor type 9
SynonymsMeg2
MMRRC Submission 039654-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R1617 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56994923-57062807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57027408 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 152 (I152S)
Ref Sequence ENSEMBL: ENSMUSP00000034832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034832] [ENSMUST00000216034]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034832
AA Change: I152S

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034832
Gene: ENSMUSG00000032290
AA Change: I152S

DomainStartEndE-ValueType
CRAL_TRIO_N 43 68 1.14e0 SMART
SEC14 90 240 7.33e-40 SMART
PTPc 302 576 1.01e-136 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216034
AA Change: I75S

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.8813 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain that shares a significant similarity with yeast SEC14, which is a protein that has phosphatidylinositol transfer activity and is required for protein secretion through the Golgi complex in yeast. This PTP was found to be activated by polyphosphoinositide, and is thought to be involved in signaling events regulating phagocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display hemorrhages, craniofacial anomalies, neural tube defects such as exencephaly and meningomyeloceles, cerebral infarctions, abnormal bone development, and >90% late embryonic lethality in addition to severe defectsin T lymphocyte and platelet activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,937 I91K probably damaging Het
Adamts16 T A 13: 70,798,035 M254L probably benign Het
Adgre5 T C 8: 83,730,177 I192V possibly damaging Het
Akr1c21 G A 13: 4,576,352 probably null Het
Amz2 A G 11: 109,434,024 T245A probably benign Het
Aqp7 A C 4: 41,036,109 M43R probably null Het
Arid3c G A 4: 41,725,103 P315S probably damaging Het
Birc2 A T 9: 7,826,951 Y345N possibly damaging Het
Blnk T C 19: 40,962,363 T115A probably benign Het
Col5a1 T C 2: 27,952,381 S423P unknown Het
Corin A T 5: 72,503,952 F66Y possibly damaging Het
Cpd A T 11: 76,846,669 W100R probably damaging Het
Cpsf1 A T 15: 76,602,370 Y296* probably null Het
Cyp2d34 T C 15: 82,620,845 T5A probably benign Het
Dhrs7c G T 11: 67,815,077 V219L possibly damaging Het
Dnah3 T C 7: 120,089,946 M82V probably benign Het
Dnah9 A G 11: 65,895,921 S3629P probably damaging Het
Fam160a2 A G 7: 105,385,062 L454P probably damaging Het
Fbrs T C 7: 127,487,711 L33P probably damaging Het
Galnt11 T A 5: 25,258,893 S388T probably damaging Het
Glmp A G 3: 88,328,119 probably benign Het
Gm13178 T G 4: 144,715,391 T97P probably damaging Het
Gm13212 A T 4: 145,624,307 probably benign Het
Gm9268 A G 7: 43,024,079 E187G probably benign Het
Gm9894 A G 13: 67,772,726 noncoding transcript Het
Grik3 A G 4: 125,691,192 M618V probably benign Het
Hmcn1 T C 1: 150,745,027 D1144G probably damaging Het
Hnrnpa2b1 T C 6: 51,466,398 K161R possibly damaging Het
Kmt2c T C 5: 25,375,927 I523V probably benign Het
Lmln C T 16: 33,117,130 P622S probably damaging Het
Lmtk2 A G 5: 144,173,862 T467A probably damaging Het
Map1s T A 8: 70,913,451 N333K probably damaging Het
Mgat4d C A 8: 83,365,711 A242D probably damaging Het
Muc5b T A 7: 141,863,524 Y3402* probably null Het
Myo3b G T 2: 70,281,218 A922S probably benign Het
Nphs1 T C 7: 30,482,531 V1183A probably benign Het
Nup160 T A 2: 90,679,499 C31S probably benign Het
Olfr1061 A T 2: 86,413,691 Y120* probably null Het
Olfr48 T C 2: 89,844,254 T240A probably benign Het
Pcdhb5 T G 18: 37,321,402 Y278* probably null Het
Pkhd1 T A 1: 20,198,050 E3368V possibly damaging Het
Pla2g6 A G 15: 79,289,141 M676T probably benign Het
Plcb1 A T 2: 135,337,441 N590Y probably damaging Het
Prr12 G A 7: 45,049,594 probably benign Het
Psat1 A G 19: 15,924,302 probably null Het
Ric8b T A 10: 84,947,611 F111Y probably damaging Het
Slc44a3 G A 3: 121,461,265 A568V probably benign Het
Smarcd3 T G 5: 24,595,194 R213S probably damaging Het
Snx13 T C 12: 35,086,896 Y119H probably damaging Het
Socs2 C A 10: 95,413,081 E57* probably null Het
Spred1 C T 2: 117,175,347 P197S probably benign Het
Srek1 G T 13: 103,743,604 P482Q unknown Het
Tapbp A G 17: 33,920,431 T134A probably benign Het
Tarbp1 T C 8: 126,444,268 I998V possibly damaging Het
Tbcel G T 9: 42,461,293 probably benign Het
Tec A G 5: 72,782,105 F189S probably damaging Het
Tmprss11g A T 5: 86,499,563 Y39N probably damaging Het
Tmtc1 A G 6: 148,355,404 probably benign Het
Trpa1 A G 1: 14,873,675 I1070T probably damaging Het
Trpm2 T A 10: 77,935,875 probably null Het
Ttc21b G T 2: 66,226,035 T669K probably benign Het
Ttll4 G A 1: 74,679,401 R137H probably benign Het
Ubqln3 G T 7: 104,142,860 L8I possibly damaging Het
Ung C A 5: 114,131,354 N42K probably benign Het
Upp1 T C 11: 9,134,865 S195P probably damaging Het
Urb1 T C 16: 90,760,452 E1762G possibly damaging Het
Utp11 T C 4: 124,686,111 K35E probably damaging Het
Vav3 A T 3: 109,510,978 K305I probably damaging Het
Vmn1r197 A G 13: 22,328,328 I140V possibly damaging Het
Zfc3h1 A G 10: 115,390,922 T295A probably benign Het
Zfp46 T C 4: 136,290,512 L219P probably damaging Het
Zfp493 G A 13: 67,783,880 V33M probably damaging Het
Zfp92 T C X: 73,419,860 probably benign Het
Other mutations in Ptpn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Ptpn9 APN 9 57036703 missense possibly damaging 0.68
IGL01388:Ptpn9 APN 9 57036718 missense probably benign 0.00
IGL01953:Ptpn9 APN 9 57056788 missense possibly damaging 0.69
IGL02525:Ptpn9 APN 9 57036725 nonsense probably null
IGL03294:Ptpn9 APN 9 57027387 missense possibly damaging 0.79
PIT4486001:Ptpn9 UTSW 9 57061003 missense probably damaging 0.99
R0530:Ptpn9 UTSW 9 57061133 missense probably benign
R1964:Ptpn9 UTSW 9 57059912 missense probably damaging 1.00
R2426:Ptpn9 UTSW 9 57027428 missense possibly damaging 0.61
R4394:Ptpn9 UTSW 9 57036563 missense possibly damaging 0.91
R4606:Ptpn9 UTSW 9 57022211 missense possibly damaging 0.71
R4658:Ptpn9 UTSW 9 57020037 missense probably benign 0.01
R4660:Ptpn9 UTSW 9 57036498 missense probably benign 0.17
R5141:Ptpn9 UTSW 9 57036676 missense possibly damaging 0.56
R5150:Ptpn9 UTSW 9 57036670 missense probably benign
R5289:Ptpn9 UTSW 9 57060063 critical splice donor site probably null
R5389:Ptpn9 UTSW 9 57056837 intron probably benign
R5422:Ptpn9 UTSW 9 57033157 missense probably damaging 1.00
R5437:Ptpn9 UTSW 9 57020037 missense possibly damaging 0.80
R6075:Ptpn9 UTSW 9 57061146 missense probably benign 0.00
R6084:Ptpn9 UTSW 9 57033163 nonsense probably null
R6481:Ptpn9 UTSW 9 57023040 missense probably damaging 1.00
R7120:Ptpn9 UTSW 9 57059882 missense probably damaging 1.00
R7194:Ptpn9 UTSW 9 57022286 missense probably damaging 1.00
R7195:Ptpn9 UTSW 9 57022249 missense probably benign 0.02
R7349:Ptpn9 UTSW 9 57044376 missense probably benign 0.16
R7439:Ptpn9 UTSW 9 57027433 nonsense probably null
R7441:Ptpn9 UTSW 9 57027433 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATGCATAAAACCCTCTGGAAAACAAC -3'
(R):5'- GGACCTCACCCCTTACATAGCTCA -3'

Sequencing Primer
(F):5'- atggtggaaggaaaggacag -3'
(R):5'- cacttccttgaactcagaaatcc -3'
Posted On2014-04-24