Incidental Mutation 'R1617:Akr1c21'
Institutional Source Beutler Lab
Gene Symbol Akr1c21
Ensembl Gene ENSMUSG00000021207
Gene Namealdo-keto reductase family 1, member C21
MMRRC Submission 039654-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1617 (G1)
Quality Score225
Status Validated
Chromosomal Location4574075-4586541 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 4576352 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021628] [ENSMUST00000223285]
PDB Structure
Crystal structure of 17alpha-hydroxysteroid dehydrogenase in binary complex with NADP(H) in an open conformation [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase in its apo-form [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase in complex with NADP(H) in a closed conformation [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase in complex with NADP+ and epi-testosterone [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase mutant K31A in complex with NADP+ and epi-testosterone [X-RAY DIFFRACTION]
Crystal structure of mouse 17-alpha hydroxysteroid dehydrogenase in complex with coenzyme NADPH [X-RAY DIFFRACTION]
The crystal structure of mouse 17-alpha hydroxysteroid dehydrogenase GG225.226PP mutant in complex with inhibitor and cofactor NADP+. [X-RAY DIFFRACTION]
The crystal structure of 17-alpha hydroxysteroid dehydrogenase Y224D mutant. [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000021628
SMART Domains Protein: ENSMUSP00000021628
Gene: ENSMUSG00000021207

Pfam:Aldo_ket_red 18 301 2.2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137279
Predicted Effect probably benign
Transcript: ENSMUST00000223285
Meta Mutation Damage Score 0.5992 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency 98% (83/85)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,937 I91K probably damaging Het
Adamts16 T A 13: 70,798,035 M254L probably benign Het
Adgre5 T C 8: 83,730,177 I192V possibly damaging Het
Amz2 A G 11: 109,434,024 T245A probably benign Het
Aqp7 A C 4: 41,036,109 M43R probably null Het
Arid3c G A 4: 41,725,103 P315S probably damaging Het
Birc2 A T 9: 7,826,951 Y345N possibly damaging Het
Blnk T C 19: 40,962,363 T115A probably benign Het
Col5a1 T C 2: 27,952,381 S423P unknown Het
Corin A T 5: 72,503,952 F66Y possibly damaging Het
Cpd A T 11: 76,846,669 W100R probably damaging Het
Cpsf1 A T 15: 76,602,370 Y296* probably null Het
Cyp2d34 T C 15: 82,620,845 T5A probably benign Het
Dhrs7c G T 11: 67,815,077 V219L possibly damaging Het
Dnah3 T C 7: 120,089,946 M82V probably benign Het
Dnah9 A G 11: 65,895,921 S3629P probably damaging Het
Fam160a2 A G 7: 105,385,062 L454P probably damaging Het
Fbrs T C 7: 127,487,711 L33P probably damaging Het
Galnt11 T A 5: 25,258,893 S388T probably damaging Het
Glmp A G 3: 88,328,119 probably benign Het
Gm13178 T G 4: 144,715,391 T97P probably damaging Het
Gm13212 A T 4: 145,624,307 probably benign Het
Gm9268 A G 7: 43,024,079 E187G probably benign Het
Gm9894 A G 13: 67,772,726 noncoding transcript Het
Grik3 A G 4: 125,691,192 M618V probably benign Het
Hmcn1 T C 1: 150,745,027 D1144G probably damaging Het
Hnrnpa2b1 T C 6: 51,466,398 K161R possibly damaging Het
Kmt2c T C 5: 25,375,927 I523V probably benign Het
Lmln C T 16: 33,117,130 P622S probably damaging Het
Lmtk2 A G 5: 144,173,862 T467A probably damaging Het
Map1s T A 8: 70,913,451 N333K probably damaging Het
Mgat4d C A 8: 83,365,711 A242D probably damaging Het
Muc5b T A 7: 141,863,524 Y3402* probably null Het
Myo3b G T 2: 70,281,218 A922S probably benign Het
Nphs1 T C 7: 30,482,531 V1183A probably benign Het
Nup160 T A 2: 90,679,499 C31S probably benign Het
Olfr1061 A T 2: 86,413,691 Y120* probably null Het
Olfr48 T C 2: 89,844,254 T240A probably benign Het
Pcdhb5 T G 18: 37,321,402 Y278* probably null Het
Pkhd1 T A 1: 20,198,050 E3368V possibly damaging Het
Pla2g6 A G 15: 79,289,141 M676T probably benign Het
Plcb1 A T 2: 135,337,441 N590Y probably damaging Het
Prr12 G A 7: 45,049,594 probably benign Het
Psat1 A G 19: 15,924,302 probably null Het
Ptpn9 T G 9: 57,027,408 I152S possibly damaging Het
Ric8b T A 10: 84,947,611 F111Y probably damaging Het
Slc44a3 G A 3: 121,461,265 A568V probably benign Het
Smarcd3 T G 5: 24,595,194 R213S probably damaging Het
Snx13 T C 12: 35,086,896 Y119H probably damaging Het
Socs2 C A 10: 95,413,081 E57* probably null Het
Spred1 C T 2: 117,175,347 P197S probably benign Het
Srek1 G T 13: 103,743,604 P482Q unknown Het
Tapbp A G 17: 33,920,431 T134A probably benign Het
Tarbp1 T C 8: 126,444,268 I998V possibly damaging Het
Tbcel G T 9: 42,461,293 probably benign Het
Tec A G 5: 72,782,105 F189S probably damaging Het
Tmprss11g A T 5: 86,499,563 Y39N probably damaging Het
Tmtc1 A G 6: 148,355,404 probably benign Het
Trpa1 A G 1: 14,873,675 I1070T probably damaging Het
Trpm2 T A 10: 77,935,875 probably null Het
Ttc21b G T 2: 66,226,035 T669K probably benign Het
Ttll4 G A 1: 74,679,401 R137H probably benign Het
Ubqln3 G T 7: 104,142,860 L8I possibly damaging Het
Ung C A 5: 114,131,354 N42K probably benign Het
Upp1 T C 11: 9,134,865 S195P probably damaging Het
Urb1 T C 16: 90,760,452 E1762G possibly damaging Het
Utp11 T C 4: 124,686,111 K35E probably damaging Het
Vav3 A T 3: 109,510,978 K305I probably damaging Het
Vmn1r197 A G 13: 22,328,328 I140V possibly damaging Het
Zfc3h1 A G 10: 115,390,922 T295A probably benign Het
Zfp46 T C 4: 136,290,512 L219P probably damaging Het
Zfp493 G A 13: 67,783,880 V33M probably damaging Het
Zfp92 T C X: 73,419,860 probably benign Het
Other mutations in Akr1c21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Akr1c21 APN 13 4576313 missense probably damaging 1.00
IGL01093:Akr1c21 APN 13 4581140 splice site probably benign
IGL01408:Akr1c21 APN 13 4577432 missense probably benign
IGL02470:Akr1c21 APN 13 4577407 missense probably damaging 1.00
IGL02683:Akr1c21 APN 13 4576313 missense probably damaging 1.00
IGL02738:Akr1c21 APN 13 4580301 missense probably damaging 1.00
IGL03126:Akr1c21 APN 13 4577458 missense possibly damaging 0.76
IGL03365:Akr1c21 APN 13 4583852 missense probably benign 0.00
R0166:Akr1c21 UTSW 13 4581264 missense probably damaging 1.00
R0391:Akr1c21 UTSW 13 4581200 missense probably damaging 1.00
R0505:Akr1c21 UTSW 13 4576307 missense probably damaging 1.00
R1069:Akr1c21 UTSW 13 4575334 splice site probably benign
R1168:Akr1c21 UTSW 13 4583837 missense probably benign 0.04
R1686:Akr1c21 UTSW 13 4577453 missense probably damaging 1.00
R1694:Akr1c21 UTSW 13 4575178 missense probably damaging 0.98
R1753:Akr1c21 UTSW 13 4577135 nonsense probably null
R1977:Akr1c21 UTSW 13 4574212 missense probably damaging 1.00
R2005:Akr1c21 UTSW 13 4574215 missense probably damaging 1.00
R2036:Akr1c21 UTSW 13 4576306 missense probably damaging 0.98
R2198:Akr1c21 UTSW 13 4577465 missense probably damaging 1.00
R2925:Akr1c21 UTSW 13 4576350 splice site probably null
R4965:Akr1c21 UTSW 13 4580305 missense probably damaging 1.00
R6245:Akr1c21 UTSW 13 4575232 missense possibly damaging 0.93
R6381:Akr1c21 UTSW 13 4574184 missense probably damaging 1.00
R6711:Akr1c21 UTSW 13 4577375 missense probably damaging 1.00
R6843:Akr1c21 UTSW 13 4575214 missense probably damaging 1.00
R6998:Akr1c21 UTSW 13 4583851 missense probably benign 0.05
R7253:Akr1c21 UTSW 13 4577140 missense probably damaging 1.00
R7475:Akr1c21 UTSW 13 4576319 missense probably benign 0.09
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- accttccccttccacattaac -3'
Posted On2014-04-24