Incidental Mutation 'R1617:Vmn1r197'
ID174383
Institutional Source Beutler Lab
Gene Symbol Vmn1r197
Ensembl Gene ENSMUSG00000069294
Gene Namevomeronasal 1 receptor 197
SynonymsV1rh21
MMRRC Submission 039654-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1617 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22324589-22332866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22328328 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 140 (I140V)
Ref Sequence ENSEMBL: ENSMUSP00000154632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091734] [ENSMUST00000226225] [ENSMUST00000227017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091734
AA Change: I140V

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089328
Gene: ENSMUSG00000069294
AA Change: I140V

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Pfam:V1R 31 297 1.4e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226225
AA Change: I140V

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227017
AA Change: I140V

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency 98% (83/85)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,937 I91K probably damaging Het
Adamts16 T A 13: 70,798,035 M254L probably benign Het
Adgre5 T C 8: 83,730,177 I192V possibly damaging Het
Akr1c21 G A 13: 4,576,352 probably null Het
Amz2 A G 11: 109,434,024 T245A probably benign Het
Aqp7 A C 4: 41,036,109 M43R probably null Het
Arid3c G A 4: 41,725,103 P315S probably damaging Het
Birc2 A T 9: 7,826,951 Y345N possibly damaging Het
Blnk T C 19: 40,962,363 T115A probably benign Het
Col5a1 T C 2: 27,952,381 S423P unknown Het
Corin A T 5: 72,503,952 F66Y possibly damaging Het
Cpd A T 11: 76,846,669 W100R probably damaging Het
Cpsf1 A T 15: 76,602,370 Y296* probably null Het
Cyp2d34 T C 15: 82,620,845 T5A probably benign Het
Dhrs7c G T 11: 67,815,077 V219L possibly damaging Het
Dnah3 T C 7: 120,089,946 M82V probably benign Het
Dnah9 A G 11: 65,895,921 S3629P probably damaging Het
Fam160a2 A G 7: 105,385,062 L454P probably damaging Het
Fbrs T C 7: 127,487,711 L33P probably damaging Het
Galnt11 T A 5: 25,258,893 S388T probably damaging Het
Glmp A G 3: 88,328,119 probably benign Het
Gm13178 T G 4: 144,715,391 T97P probably damaging Het
Gm13212 A T 4: 145,624,307 probably benign Het
Gm9268 A G 7: 43,024,079 E187G probably benign Het
Gm9894 A G 13: 67,772,726 noncoding transcript Het
Grik3 A G 4: 125,691,192 M618V probably benign Het
Hmcn1 T C 1: 150,745,027 D1144G probably damaging Het
Hnrnpa2b1 T C 6: 51,466,398 K161R possibly damaging Het
Kmt2c T C 5: 25,375,927 I523V probably benign Het
Lmln C T 16: 33,117,130 P622S probably damaging Het
Lmtk2 A G 5: 144,173,862 T467A probably damaging Het
Map1s T A 8: 70,913,451 N333K probably damaging Het
Mgat4d C A 8: 83,365,711 A242D probably damaging Het
Muc5b T A 7: 141,863,524 Y3402* probably null Het
Myo3b G T 2: 70,281,218 A922S probably benign Het
Nphs1 T C 7: 30,482,531 V1183A probably benign Het
Nup160 T A 2: 90,679,499 C31S probably benign Het
Olfr1061 A T 2: 86,413,691 Y120* probably null Het
Olfr48 T C 2: 89,844,254 T240A probably benign Het
Pcdhb5 T G 18: 37,321,402 Y278* probably null Het
Pkhd1 T A 1: 20,198,050 E3368V possibly damaging Het
Pla2g6 A G 15: 79,289,141 M676T probably benign Het
Plcb1 A T 2: 135,337,441 N590Y probably damaging Het
Prr12 G A 7: 45,049,594 probably benign Het
Psat1 A G 19: 15,924,302 probably null Het
Ptpn9 T G 9: 57,027,408 I152S possibly damaging Het
Ric8b T A 10: 84,947,611 F111Y probably damaging Het
Slc44a3 G A 3: 121,461,265 A568V probably benign Het
Smarcd3 T G 5: 24,595,194 R213S probably damaging Het
Snx13 T C 12: 35,086,896 Y119H probably damaging Het
Socs2 C A 10: 95,413,081 E57* probably null Het
Spred1 C T 2: 117,175,347 P197S probably benign Het
Srek1 G T 13: 103,743,604 P482Q unknown Het
Tapbp A G 17: 33,920,431 T134A probably benign Het
Tarbp1 T C 8: 126,444,268 I998V possibly damaging Het
Tbcel G T 9: 42,461,293 probably benign Het
Tec A G 5: 72,782,105 F189S probably damaging Het
Tmprss11g A T 5: 86,499,563 Y39N probably damaging Het
Tmtc1 A G 6: 148,355,404 probably benign Het
Trpa1 A G 1: 14,873,675 I1070T probably damaging Het
Trpm2 T A 10: 77,935,875 probably null Het
Ttc21b G T 2: 66,226,035 T669K probably benign Het
Ttll4 G A 1: 74,679,401 R137H probably benign Het
Ubqln3 G T 7: 104,142,860 L8I possibly damaging Het
Ung C A 5: 114,131,354 N42K probably benign Het
Upp1 T C 11: 9,134,865 S195P probably damaging Het
Urb1 T C 16: 90,760,452 E1762G possibly damaging Het
Utp11 T C 4: 124,686,111 K35E probably damaging Het
Vav3 A T 3: 109,510,978 K305I probably damaging Het
Zfc3h1 A G 10: 115,390,922 T295A probably benign Het
Zfp46 T C 4: 136,290,512 L219P probably damaging Het
Zfp493 G A 13: 67,783,880 V33M probably damaging Het
Zfp92 T C X: 73,419,860 probably benign Het
Other mutations in Vmn1r197
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Vmn1r197 APN 13 22328071 missense probably benign 0.07
IGL01944:Vmn1r197 APN 13 22328338 missense possibly damaging 0.77
IGL02317:Vmn1r197 APN 13 22327903 utr 5 prime probably benign
IGL02487:Vmn1r197 APN 13 22328622 missense probably damaging 1.00
R0443:Vmn1r197 UTSW 13 22328071 missense possibly damaging 0.90
R1511:Vmn1r197 UTSW 13 22328653 missense possibly damaging 0.92
R1542:Vmn1r197 UTSW 13 22328350 missense probably benign 0.01
R1739:Vmn1r197 UTSW 13 22328371 missense possibly damaging 0.80
R3739:Vmn1r197 UTSW 13 22328576 nonsense probably null
R4761:Vmn1r197 UTSW 13 22328004 missense probably benign 0.00
R5335:Vmn1r197 UTSW 13 22328191 missense probably damaging 1.00
R6168:Vmn1r197 UTSW 13 22328508 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGTTCCAAAGCACTGAGCAGAAACC -3'
(R):5'- TGGCACCCTGAAACACTGCATC -3'

Sequencing Primer
(F):5'- GCTTCTTTCAAAAGGGATGCC -3'
(R):5'- TGAAACACTGCATCTCTCAGC -3'
Posted On2014-04-24