Incidental Mutation 'R1618:Slc33a1'
ID174416
Institutional Source Beutler Lab
Gene Symbol Slc33a1
Ensembl Gene ENSMUSG00000027822
Gene Namesolute carrier family 33 (acetyl-CoA transporter), member 1
SynonymsD630022N01Rik, Acatn
MMRRC Submission 039655-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R1618 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location63933507-63964768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63948229 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 332 (T332A)
Ref Sequence ENSEMBL: ENSMUSP00000123986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029402] [ENSMUST00000160883] [ENSMUST00000161659]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029402
AA Change: T332A

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029402
Gene: ENSMUSG00000027822
AA Change: T332A

DomainStartEndE-ValueType
Pfam:Acatn 74 292 2.4e-77 PFAM
Pfam:Acatn 282 546 7.1e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160883
AA Change: T332A

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125713
Gene: ENSMUSG00000027822
AA Change: T332A

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161659
AA Change: T332A

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123986
Gene: ENSMUSG00000027822
AA Change: T332A

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Meta Mutation Damage Score 0.5283 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the formation of O-acetylated (Ac) gangliosides. The encoded protein is predicted to contain 6 to 10 transmembrane domains, and a leucine zipper motif in transmembrane domain III. Defects in this gene have been reported to cause spastic paraplegia autosomal dominant type 42 (SPG42) in one Chinese family, but not in similar patients of European descent. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a serine to arginine substitution at amino acid 113 show early embryonic growth arrest. Adult heterozygotes display aberrant inflammatory response, increased propensity to infections and malignancies, degenerative features of the PNS and CNS, and abnormal induction of autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449E01Rik T C 14: 105,498,946 noncoding transcript Het
Abca8b A T 11: 109,949,888 probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Anln A G 9: 22,350,918 probably null Het
Anpep T G 7: 79,835,417 Q607P probably benign Het
Arl13b A C 16: 62,813,277 probably null Het
Asxl3 T C 18: 22,516,987 S678P probably damaging Het
Atf6b C T 17: 34,647,728 Q58* probably null Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Cfap46 T A 7: 139,652,810 M782L probably benign Het
Cngb3 T C 4: 19,364,260 S155P probably benign Het
Coro1a T C 7: 126,701,547 I162V probably benign Het
Cry1 T A 10: 85,146,454 I343F probably damaging Het
Csnk1e A T 15: 79,424,850 M292K probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cul9 A T 17: 46,525,892 M1069K probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dnah11 T C 12: 118,015,465 I2633V probably damaging Het
Eif4g3 C A 4: 138,206,058 D1731E probably damaging Het
Epb41l4b T C 4: 57,032,204 T592A probably benign Het
Evi5 T C 5: 107,799,118 probably benign Het
Exo1 T A 1: 175,901,386 M672K probably benign Het
Fcho1 T C 8: 71,710,403 S661G probably damaging Het
Fnip2 A G 3: 79,508,168 Y188H possibly damaging Het
Foxb1 T C 9: 69,760,011 D79G probably damaging Het
Fyco1 T C 9: 123,829,281 Y610C probably damaging Het
Gm3095 C A 14: 3,964,571 N96K probably damaging Het
Gm3095 T A 14: 3,964,572 Y97N probably damaging Het
Gmfb A T 14: 46,811,780 L128* probably null Het
Gprc5c T A 11: 114,864,394 V299D possibly damaging Het
Hsfy2 C T 1: 56,637,229 V50I probably benign Het
Hspa12b A C 2: 131,140,929 K236Q probably benign Het
Impg2 A G 16: 56,259,858 Y566C probably damaging Het
Itpr3 A C 17: 27,116,607 probably null Het
Kprp G A 3: 92,825,476 T89I probably damaging Het
Lcmt2 T C 2: 121,138,652 E650G probably damaging Het
Lrch1 T C 14: 74,813,704 D331G probably damaging Het
Mroh9 T A 1: 163,024,541 I860F probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myt1l A G 12: 29,827,397 D349G unknown Het
Ndufs2 T C 1: 171,246,121 T31A probably benign Het
Ndufs3 A T 2: 90,898,672 S157T probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Noct T A 3: 51,247,830 S6R probably damaging Het
Npas2 T A 1: 39,300,727 H119Q probably damaging Het
Olfr1076 T G 2: 86,508,849 L130R probably damaging Het
Olfr1206 A G 2: 88,865,527 probably null Het
Olfr138 G A 17: 38,275,666 probably null Het
Oprl1 A T 2: 181,718,853 Y207F probably benign Het
Palm3 G T 8: 84,029,662 S601I possibly damaging Het
Plscr1 T A 9: 92,266,495 C163S probably damaging Het
Ptprk A T 10: 28,493,170 M713L probably benign Het
Rdm1 A G 11: 101,628,391 D72G possibly damaging Het
Reln T C 5: 22,060,368 D442G probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sbno1 T C 5: 124,404,216 Y338C probably damaging Het
Seh1l T G 18: 67,788,736 V222G probably damaging Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Slc25a18 A C 6: 120,786,342 probably benign Het
Slc35d3 A G 10: 19,849,163 S316P probably benign Het
Spata48 A G 11: 11,488,641 probably benign Het
Srrm2 T A 17: 23,818,932 probably benign Het
Srsf12 C T 4: 33,230,974 S156L probably damaging Het
Syce3 A G 15: 89,390,403 M49T probably benign Het
Tjp3 T C 10: 81,276,260 probably benign Het
Tnks G T 8: 34,875,276 N373K probably damaging Het
Togaram1 A G 12: 64,967,073 N366S possibly damaging Het
Trpm1 G A 7: 64,240,535 R962H probably damaging Het
Trpm6 A T 19: 18,877,631 M1885L possibly damaging Het
Tshz3 A G 7: 36,771,796 D1070G probably damaging Het
Ush2a T C 1: 188,814,224 M3399T probably benign Het
Utp15 G A 13: 98,257,187 T196I probably benign Het
Vmn1r168 T C 7: 23,541,300 I194T probably benign Het
Vmn2r73 C T 7: 85,875,912 W9* probably null Het
Wdr17 T C 8: 54,639,895 Y1076C probably damaging Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zbtb46 A T 2: 181,424,249 V36E possibly damaging Het
Zfp558 T C 9: 18,469,283 I9M possibly damaging Het
Zscan2 T A 7: 80,875,786 Y418* probably null Het
Other mutations in Slc33a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Slc33a1 APN 3 63964012 missense probably benign
IGL01361:Slc33a1 APN 3 63943412 missense probably damaging 0.96
IGL01564:Slc33a1 APN 3 63943347 missense probably benign 0.01
IGL02027:Slc33a1 APN 3 63948141 missense probably damaging 1.00
IGL02598:Slc33a1 APN 3 63943332 missense probably benign
IGL02877:Slc33a1 APN 3 63943385 missense probably benign
IGL03196:Slc33a1 APN 3 63963730 missense possibly damaging 0.46
IGL03269:Slc33a1 APN 3 63963757 missense probably damaging 0.98
R0973:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R0973:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R0974:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R1171:Slc33a1 UTSW 3 63953894 missense probably benign
R1513:Slc33a1 UTSW 3 63963955 missense probably damaging 1.00
R2038:Slc33a1 UTSW 3 63948156 missense probably damaging 1.00
R2095:Slc33a1 UTSW 3 63963955 missense probably damaging 1.00
R3927:Slc33a1 UTSW 3 63963724 missense probably benign 0.19
R5204:Slc33a1 UTSW 3 63963746 missense probably damaging 1.00
R6371:Slc33a1 UTSW 3 63943288 missense probably benign
R6425:Slc33a1 UTSW 3 63964063 missense probably benign
R6641:Slc33a1 UTSW 3 63953906 missense probably benign 0.09
R6709:Slc33a1 UTSW 3 63944701 missense possibly damaging 0.89
R6866:Slc33a1 UTSW 3 63943323 missense probably benign 0.02
R7360:Slc33a1 UTSW 3 63947654 missense possibly damaging 0.87
R7768:Slc33a1 UTSW 3 63947618 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CACTGACGATGTTCATGCCTACCC -3'
(R):5'- CTTATAACTTGGCATCTGTGCGCTTG -3'

Sequencing Primer
(F):5'- TACCCTGACATGCACTATTCTAAAG -3'
(R):5'- CTTGTGACTGATGGGCCAATG -3'
Posted On2014-04-24