Incidental Mutation 'R1618:Camsap3'
Institutional Source Beutler Lab
Gene Symbol Camsap3
Ensembl Gene ENSMUSG00000044433
Gene Namecalmodulin regulated spectrin-associated protein family, member 3
SynonymsNezha, 2310057J16Rik
MMRRC Submission 039655-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R1618 (G1)
Quality Score225
Status Validated
Chromosomal Location3587293-3609075 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3598740 bp
Amino Acid Change Threonine to Alanine at position 20 (T20A)
Ref Sequence ENSEMBL: ENSMUSP00000147231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057028] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208036] [ENSMUST00000208240]
Predicted Effect probably benign
Transcript: ENSMUST00000057028
AA Change: T153A

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433
AA Change: T153A

low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171962
AA Change: T153A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433
AA Change: T153A

low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207077
AA Change: T153A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207432
AA Change: T153A

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect unknown
Transcript: ENSMUST00000207533
AA Change: T153A
Predicted Effect unknown
Transcript: ENSMUST00000207712
AA Change: T153A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207930
Predicted Effect probably damaging
Transcript: ENSMUST00000207970
AA Change: T153A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000208036
AA Change: T20A

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208064
Predicted Effect unknown
Transcript: ENSMUST00000208240
AA Change: T153A
Meta Mutation Damage Score 0.1360 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 96% (79/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display variable penetrance of vascular, liver, nervous system, rib and eye abnormalities. Mice homozygous for an allele with loss of microtubule binding show partial lethality, decreased body size and abnormal alignment of microtubles in polarized epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449E01Rik T C 14: 105,498,946 noncoding transcript Het
Abca8b A T 11: 109,949,888 probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Anln A G 9: 22,350,918 probably null Het
Anpep T G 7: 79,835,417 Q607P probably benign Het
Arl13b A C 16: 62,813,277 probably null Het
Asxl3 T C 18: 22,516,987 S678P probably damaging Het
Atf6b C T 17: 34,647,728 Q58* probably null Het
Cfap46 T A 7: 139,652,810 M782L probably benign Het
Cngb3 T C 4: 19,364,260 S155P probably benign Het
Coro1a T C 7: 126,701,547 I162V probably benign Het
Cry1 T A 10: 85,146,454 I343F probably damaging Het
Csnk1e A T 15: 79,424,850 M292K probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cul9 A T 17: 46,525,892 M1069K probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dnah11 T C 12: 118,015,465 I2633V probably damaging Het
Eif4g3 C A 4: 138,206,058 D1731E probably damaging Het
Epb41l4b T C 4: 57,032,204 T592A probably benign Het
Evi5 T C 5: 107,799,118 probably benign Het
Exo1 T A 1: 175,901,386 M672K probably benign Het
Fcho1 T C 8: 71,710,403 S661G probably damaging Het
Fnip2 A G 3: 79,508,168 Y188H possibly damaging Het
Foxb1 T C 9: 69,760,011 D79G probably damaging Het
Fyco1 T C 9: 123,829,281 Y610C probably damaging Het
Gm3095 C A 14: 3,964,571 N96K probably damaging Het
Gm3095 T A 14: 3,964,572 Y97N probably damaging Het
Gmfb A T 14: 46,811,780 L128* probably null Het
Gprc5c T A 11: 114,864,394 V299D possibly damaging Het
Hsfy2 C T 1: 56,637,229 V50I probably benign Het
Hspa12b A C 2: 131,140,929 K236Q probably benign Het
Impg2 A G 16: 56,259,858 Y566C probably damaging Het
Itpr3 A C 17: 27,116,607 probably null Het
Kprp G A 3: 92,825,476 T89I probably damaging Het
Lcmt2 T C 2: 121,138,652 E650G probably damaging Het
Lrch1 T C 14: 74,813,704 D331G probably damaging Het
Mroh9 T A 1: 163,024,541 I860F probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myt1l A G 12: 29,827,397 D349G unknown Het
Ndufs2 T C 1: 171,246,121 T31A probably benign Het
Ndufs3 A T 2: 90,898,672 S157T probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Noct T A 3: 51,247,830 S6R probably damaging Het
Npas2 T A 1: 39,300,727 H119Q probably damaging Het
Olfr1076 T G 2: 86,508,849 L130R probably damaging Het
Olfr1206 A G 2: 88,865,527 probably null Het
Olfr138 G A 17: 38,275,666 probably null Het
Oprl1 A T 2: 181,718,853 Y207F probably benign Het
Palm3 G T 8: 84,029,662 S601I possibly damaging Het
Plscr1 T A 9: 92,266,495 C163S probably damaging Het
Ptprk A T 10: 28,493,170 M713L probably benign Het
Rdm1 A G 11: 101,628,391 D72G possibly damaging Het
Reln T C 5: 22,060,368 D442G probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sbno1 T C 5: 124,404,216 Y338C probably damaging Het
Seh1l T G 18: 67,788,736 V222G probably damaging Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Slc25a18 A C 6: 120,786,342 probably benign Het
Slc33a1 T C 3: 63,948,229 T332A possibly damaging Het
Slc35d3 A G 10: 19,849,163 S316P probably benign Het
Spata48 A G 11: 11,488,641 probably benign Het
Srrm2 T A 17: 23,818,932 probably benign Het
Srsf12 C T 4: 33,230,974 S156L probably damaging Het
Syce3 A G 15: 89,390,403 M49T probably benign Het
Tjp3 T C 10: 81,276,260 probably benign Het
Tnks G T 8: 34,875,276 N373K probably damaging Het
Togaram1 A G 12: 64,967,073 N366S possibly damaging Het
Trpm1 G A 7: 64,240,535 R962H probably damaging Het
Trpm6 A T 19: 18,877,631 M1885L possibly damaging Het
Tshz3 A G 7: 36,771,796 D1070G probably damaging Het
Ush2a T C 1: 188,814,224 M3399T probably benign Het
Utp15 G A 13: 98,257,187 T196I probably benign Het
Vmn1r168 T C 7: 23,541,300 I194T probably benign Het
Vmn2r73 C T 7: 85,875,912 W9* probably null Het
Wdr17 T C 8: 54,639,895 Y1076C probably damaging Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zbtb46 A T 2: 181,424,249 V36E possibly damaging Het
Zfp558 T C 9: 18,469,283 I9M possibly damaging Het
Zscan2 T A 7: 80,875,786 Y418* probably null Het
Other mutations in Camsap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Camsap3 APN 8 3602077 missense probably damaging 1.00
IGL00797:Camsap3 APN 8 3602115 splice site probably benign
IGL01457:Camsap3 APN 8 3604795 missense probably damaging 0.98
IGL01833:Camsap3 APN 8 3608508 missense probably damaging 1.00
IGL02095:Camsap3 APN 8 3603845 missense probably damaging 1.00
IGL02880:Camsap3 APN 8 3603913 missense probably damaging 1.00
R0005:Camsap3 UTSW 8 3604288 missense probably damaging 1.00
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0347:Camsap3 UTSW 8 3602029 missense probably damaging 1.00
R0926:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R0946:Camsap3 UTSW 8 3604442 missense probably benign 0.00
R1169:Camsap3 UTSW 8 3603866 missense probably damaging 1.00
R1206:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1454:Camsap3 UTSW 8 3603968 missense possibly damaging 0.58
R1475:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1581:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1820:Camsap3 UTSW 8 3603485 missense probably damaging 1.00
R1899:Camsap3 UTSW 8 3603922 nonsense probably null
R1914:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1952:Camsap3 UTSW 8 3604789 missense probably damaging 0.99
R2338:Camsap3 UTSW 8 3606808 missense probably damaging 1.00
R3725:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R3726:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R4528:Camsap3 UTSW 8 3606515 missense possibly damaging 0.79
R4652:Camsap3 UTSW 8 3600689 missense possibly damaging 0.87
R5025:Camsap3 UTSW 8 3604244 missense probably damaging 1.00
R5120:Camsap3 UTSW 8 3600680 missense probably damaging 0.97
R5381:Camsap3 UTSW 8 3603812 missense probably damaging 1.00
R5388:Camsap3 UTSW 8 3604276 missense probably damaging 1.00
R5829:Camsap3 UTSW 8 3597899 missense probably damaging 1.00
R5846:Camsap3 UTSW 8 3603980 missense probably damaging 1.00
R5935:Camsap3 UTSW 8 3601999 missense probably damaging 1.00
R6363:Camsap3 UTSW 8 3601971 missense probably damaging 1.00
R6469:Camsap3 UTSW 8 3603941 missense possibly damaging 0.79
R6595:Camsap3 UTSW 8 3604186 missense probably damaging 1.00
R6595:Camsap3 UTSW 8 3608742 missense probably damaging 1.00
R7024:Camsap3 UTSW 8 3608242 missense probably damaging 0.98
R7062:Camsap3 UTSW 8 3607834 unclassified probably benign
R7109:Camsap3 UTSW 8 3598087 missense possibly damaging 0.53
R7233:Camsap3 UTSW 8 3600371 missense probably damaging 0.99
R7236:Camsap3 UTSW 8 3604116 missense probably damaging 1.00
R7316:Camsap3 UTSW 8 3604648 missense possibly damaging 0.51
R7340:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R7512:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R7779:Camsap3 UTSW 8 3597887 missense probably damaging 1.00
R8134:Camsap3 UTSW 8 3598075 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccatccatccatccatccatc -3'
Posted On2014-04-24