Mutagenetix > Incidental Mutations

Incidental Mutation 'R1618:Ptprk'

174448

Institutional Source

Beutler Lab

Gene Symbol

Ptprk

Ensembl Gene

ENSMUSG00000019889

Gene Name

protein tyrosine phosphatase, receptor type, K

Synonyms

RPTPkappa, PTPk

MMRRC Submission

039655-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1618 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28074820-28597397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 28493170 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 713 (M713L)

Ref Sequence

ENSEMBL: ENSMUSP00000151986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]

Predicted Effect

probably benign
Transcript: ENSMUST00000166468
AA Change: M713L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: M713L

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
MAM	30	193	1.61e-73	SMART
IG	200	288	2.16e-8	SMART
FN3	290	373	1.48e-4	SMART
FN3	389	475	4.24e1	SMART
FN3	491	579	3.32e-7	SMART
transmembrane domain	753	774	N/A	INTRINSIC
PTPc	898	1161	3.56e-132	SMART
PTPc	1190	1455	2.68e-86	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218276
AA Change: M713L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000218359
AA Change: M713L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219478

Meta Mutation Damage Score

0.04

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.3%
20x: 89.1%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449E01Rik	T	C	14: 105,498,946		noncoding transcript	Het
Abca8b	A	T	11: 109,949,888		probably benign	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Anln	A	G	9: 22,350,918		probably null	Het
Anpep	T	G	7: 79,835,417	Q607P	probably benign	Het
Arl13b	A	C	16: 62,813,277		probably null	Het
Asxl3	T	C	18: 22,516,987	S678P	probably damaging	Het
Atf6b	C	T	17: 34,647,728	Q58*	probably null	Het
Camsap3	A	G	8: 3,598,740	T20A	probably benign	Het
Cfap46	T	A	7: 139,652,810	M782L	probably benign	Het
Cngb3	T	C	4: 19,364,260	S155P	probably benign	Het
Coro1a	T	C	7: 126,701,547	I162V	probably benign	Het
Cry1	T	A	10: 85,146,454	I343F	probably damaging	Het
Csnk1e	A	T	15: 79,424,850	M292K	probably benign	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Cul9	A	T	17: 46,525,892	M1069K	probably benign	Het
Cyp2c67	C	A	19: 39,643,264		probably benign	Het
Dnah11	T	C	12: 118,015,465	I2633V	probably damaging	Het
Eif4g3	C	A	4: 138,206,058	D1731E	probably damaging	Het
Epb41l4b	T	C	4: 57,032,204	T592A	probably benign	Het
Evi5	T	C	5: 107,799,118		probably benign	Het
Exo1	T	A	1: 175,901,386	M672K	probably benign	Het
Fcho1	T	C	8: 71,710,403	S661G	probably damaging	Het
Fnip2	A	G	3: 79,508,168	Y188H	possibly damaging	Het
Foxb1	T	C	9: 69,760,011	D79G	probably damaging	Het
Fyco1	T	C	9: 123,829,281	Y610C	probably damaging	Het
Gm3095	C	A	14: 3,964,571	N96K	probably damaging	Het
Gm3095	T	A	14: 3,964,572	Y97N	probably damaging	Het
Gmfb	A	T	14: 46,811,780	L128*	probably null	Het
Gprc5c	T	A	11: 114,864,394	V299D	possibly damaging	Het
Hsfy2	C	T	1: 56,637,229	V50I	probably benign	Het
Hspa12b	A	C	2: 131,140,929	K236Q	probably benign	Het
Impg2	A	G	16: 56,259,858	Y566C	probably damaging	Het
Itpr3	A	C	17: 27,116,607		probably null	Het
Kprp	G	A	3: 92,825,476	T89I	probably damaging	Het
Lcmt2	T	C	2: 121,138,652	E650G	probably damaging	Het
Lrch1	T	C	14: 74,813,704	D331G	probably damaging	Het
Mroh9	T	A	1: 163,024,541	I860F	probably benign	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Myt1l	A	G	12: 29,827,397	D349G	unknown	Het
Ndufs2	T	C	1: 171,246,121	T31A	probably benign	Het
Ndufs3	A	T	2: 90,898,672	S157T	probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Noct	T	A	3: 51,247,830	S6R	probably damaging	Het
Npas2	T	A	1: 39,300,727	H119Q	probably damaging	Het
Olfr1076	T	G	2: 86,508,849	L130R	probably damaging	Het
Olfr1206	A	G	2: 88,865,527		probably null	Het
Olfr138	G	A	17: 38,275,666		probably null	Het
Oprl1	A	T	2: 181,718,853	Y207F	probably benign	Het
Palm3	G	T	8: 84,029,662	S601I	possibly damaging	Het
Plscr1	T	A	9: 92,266,495	C163S	probably damaging	Het
Rdm1	A	G	11: 101,628,391	D72G	possibly damaging	Het
Reln	T	C	5: 22,060,368	D442G	probably benign	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Sbno1	T	C	5: 124,404,216	Y338C	probably damaging	Het
Seh1l	T	G	18: 67,788,736	V222G	probably damaging	Het
Sept12	T	C	16: 4,996,476	K43R	probably damaging	Het
Slc25a18	A	C	6: 120,786,342		probably benign	Het
Slc33a1	T	C	3: 63,948,229	T332A	possibly damaging	Het
Slc35d3	A	G	10: 19,849,163	S316P	probably benign	Het
Spata48	A	G	11: 11,488,641		probably benign	Het
Srrm2	T	A	17: 23,818,932		probably benign	Het
Srsf12	C	T	4: 33,230,974	S156L	probably damaging	Het
Syce3	A	G	15: 89,390,403	M49T	probably benign	Het
Tjp3	T	C	10: 81,276,260		probably benign	Het
Tnks	G	T	8: 34,875,276	N373K	probably damaging	Het
Togaram1	A	G	12: 64,967,073	N366S	possibly damaging	Het
Trpm1	G	A	7: 64,240,535	R962H	probably damaging	Het
Trpm6	A	T	19: 18,877,631	M1885L	possibly damaging	Het
Tshz3	A	G	7: 36,771,796	D1070G	probably damaging	Het
Ush2a	T	C	1: 188,814,224	M3399T	probably benign	Het
Utp15	G	A	13: 98,257,187	T196I	probably benign	Het
Vmn1r168	T	C	7: 23,541,300	I194T	probably benign	Het
Vmn2r73	C	T	7: 85,875,912	W9*	probably null	Het
Wdr17	T	C	8: 54,639,895	Y1076C	probably damaging	Het
Zan	T	C	5: 137,383,830	T5152A	unknown	Het
Zbtb46	A	T	2: 181,424,249	V36E	possibly damaging	Het
Zfp558	T	C	9: 18,469,283	I9M	possibly damaging	Het
Zscan2	T	A	7: 80,875,786	Y418*	probably null	Het

Other mutations in Ptprk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Ptprk	APN	10	28336510	missense	possibly damaging	0.92
IGL00533:Ptprk	APN	10	28585975	missense	probably damaging	0.97
IGL01062:Ptprk	APN	10	28580418	missense	probably damaging	1.00
IGL01295:Ptprk	APN	10	28475178	missense	probably benign	0.14
IGL01372:Ptprk	APN	10	28569927	missense	probably benign	0.00
IGL01452:Ptprk	APN	10	28574917	critical splice donor site	probably null
IGL01829:Ptprk	APN	10	28573387	missense	probably damaging	1.00
IGL01861:Ptprk	APN	10	28383445	missense	possibly damaging	0.80
IGL01955:Ptprk	APN	10	28595865	unclassified	probably benign
IGL02263:Ptprk	APN	10	28075114	missense	unknown
IGL02489:Ptprk	APN	10	28383472	missense	probably damaging	1.00
IGL02697:Ptprk	APN	10	28575618	missense	possibly damaging	0.85
IGL02713:Ptprk	APN	10	28592811	missense	possibly damaging	0.92
IGL02943:Ptprk	APN	10	28475176	missense	possibly damaging	0.81
IGL03240:Ptprk	APN	10	28492961	missense	probably damaging	0.99
IGL03373:Ptprk	APN	10	28566537	missense	probably damaging	1.00
LCD18:Ptprk	UTSW	10	28574987	intron	probably benign
PIT4366001:Ptprk	UTSW	10	28586019	missense	probably benign
R0010:Ptprk	UTSW	10	28585969	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0053:Ptprk	UTSW	10	28475109	missense	probably damaging	0.99
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0244:Ptprk	UTSW	10	28206225	missense	possibly damaging	0.79
R0281:Ptprk	UTSW	10	28573392	missense	probably damaging	1.00
R0387:Ptprk	UTSW	10	28354629	missense	possibly damaging	0.66
R0480:Ptprk	UTSW	10	28585947	missense	probably damaging	1.00
R0480:Ptprk	UTSW	10	28585948	missense	probably damaging	1.00
R0585:Ptprk	UTSW	10	28575668	missense	probably damaging	1.00
R0614:Ptprk	UTSW	10	28075136	missense	probably damaging	0.96
R0684:Ptprk	UTSW	10	28483298	splice site	probably benign
R1073:Ptprk	UTSW	10	28496947	critical splice donor site	probably null
R1377:Ptprk	UTSW	10	28586026	missense	probably benign	0.42
R1422:Ptprk	UTSW	10	28475280	missense	possibly damaging	0.64
R1482:Ptprk	UTSW	10	28263516	missense	probably benign	0.24
R1532:Ptprk	UTSW	10	28585630	missense	probably damaging	1.00
R1576:Ptprk	UTSW	10	28551651	missense	probably damaging	1.00
R1654:Ptprk	UTSW	10	28383647	missense	probably damaging	1.00
R1701:Ptprk	UTSW	10	28466058	missense	probably damaging	1.00
R1747:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R2033:Ptprk	UTSW	10	28592767	unclassified	probably benign
R2059:Ptprk	UTSW	10	28566603	missense	probably damaging	1.00
R2076:Ptprk	UTSW	10	28589368	missense	probably damaging	0.98
R2164:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R2260:Ptprk	UTSW	10	28206149	missense	possibly damaging	0.65
R2394:Ptprk	UTSW	10	28551717	missense	probably damaging	0.98
R2432:Ptprk	UTSW	10	28592844	missense	probably damaging	1.00
R2437:Ptprk	UTSW	10	28354713	missense	probably damaging	1.00
R2495:Ptprk	UTSW	10	28475078	splice site	probably benign
R3037:Ptprk	UTSW	10	28580478	missense	probably damaging	1.00
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3687:Ptprk	UTSW	10	28473043	missense	probably damaging	1.00
R3722:Ptprk	UTSW	10	28383623	missense	probably damaging	1.00
R3892:Ptprk	UTSW	10	28263621	missense	probably benign	0.02
R3963:Ptprk	UTSW	10	28551665	missense	probably damaging	0.99
R4077:Ptprk	UTSW	10	28263512	missense	probably benign
R4079:Ptprk	UTSW	10	28263512	missense	probably benign
R4112:Ptprk	UTSW	10	28475288	critical splice donor site	probably null
R4255:Ptprk	UTSW	10	28206245	missense	probably benign	0.14
R4523:Ptprk	UTSW	10	28466052	missense	probably damaging	0.99
R4651:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4652:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4828:Ptprk	UTSW	10	28560054	missense	probably damaging	1.00
R4829:Ptprk	UTSW	10	28580484	nonsense	probably null
R4883:Ptprk	UTSW	10	28588932	missense	probably damaging	1.00
R5004:Ptprk	UTSW	10	28586063	missense	possibly damaging	0.95
R5013:Ptprk	UTSW	10	28551717	missense	probably damaging	0.99
R5092:Ptprk	UTSW	10	28592773	missense	probably damaging	1.00
R5126:Ptprk	UTSW	10	28575644	unclassified	probably null
R5183:Ptprk	UTSW	10	28475236	missense	probably benign	0.02
R5264:Ptprk	UTSW	10	28585586	missense	probably damaging	1.00
R5304:Ptprk	UTSW	10	28592054	splice site	probably null
R5330:Ptprk	UTSW	10	28587080	missense	probably damaging	1.00
R5474:Ptprk	UTSW	10	28496930	nonsense	probably null
R5516:Ptprk	UTSW	10	28496930	nonsense	probably null
R5796:Ptprk	UTSW	10	28383575	missense	probably damaging	1.00
R5843:Ptprk	UTSW	10	28493064	missense	probably damaging	0.99
R5952:Ptprk	UTSW	10	28585675	missense	probably damaging	0.99
R6065:Ptprk	UTSW	10	28475170	missense	probably damaging	1.00
R6226:Ptprk	UTSW	10	28564103	missense	probably benign	0.02
R6264:Ptprk	UTSW	10	28566673	missense	probably damaging	1.00
R6638:Ptprk	UTSW	10	28595811	missense	probably damaging	1.00
R6843:Ptprk	UTSW	10	28591982	missense	possibly damaging	0.86
R6860:Ptprk	UTSW	10	28334484	missense	probably damaging	1.00
R6869:Ptprk	UTSW	10	28473059	critical splice donor site	probably null
R7214:Ptprk	UTSW	10	28574909	missense	probably benign	0.11
R7307:Ptprk	UTSW	10	28589008	nonsense	probably null
R7349:Ptprk	UTSW	10	28592838	missense	possibly damaging	0.85
R7442:Ptprk	UTSW	10	28574819	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGTTACATACCAGAACGCCCTAAG -3'
(R):5'- AAGCGCGAGCTAAGGCAGTTAC -3'

Sequencing Primer
(F):5'- AACTTCCCCCTGGGAATCTT -3'
(R):5'- CAGGAATCCTGTGAAATGCTGC -3'

Posted On

2014-04-24