Incidental Mutation 'R1618:Srrm2'
ID174473
Institutional Source Beutler Lab
Gene Symbol Srrm2
Ensembl Gene ENSMUSG00000039218
Gene Nameserine/arginine repetitive matrix 2
Synonyms5033413A03Rik, SRm300
MMRRC Submission 039655-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R1618 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23790662-23824741 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 23818932 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000088621] [ENSMUST00000190686]
Predicted Effect unknown
Transcript: ENSMUST00000088621
AA Change: S1517T
SMART Domains Protein: ENSMUSP00000085993
Gene: ENSMUSG00000039218
AA Change: S1517T

DomainStartEndE-ValueType
low complexity region 82 157 N/A INTRINSIC
low complexity region 161 188 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
internal_repeat_4 248 305 2.93e-5 PROSPERO
internal_repeat_5 259 388 2.93e-5 PROSPERO
low complexity region 407 423 N/A INTRINSIC
CTD 464 584 5.25e-14 SMART
low complexity region 652 682 N/A INTRINSIC
low complexity region 689 721 N/A INTRINSIC
internal_repeat_6 732 778 4.88e-5 PROSPERO
low complexity region 779 795 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
internal_repeat_2 859 1124 6.34e-6 PROSPERO
internal_repeat_1 1055 1183 3.81e-6 PROSPERO
internal_repeat_4 1113 1166 2.93e-5 PROSPERO
internal_repeat_6 1169 1213 4.88e-5 PROSPERO
low complexity region 1236 1244 N/A INTRINSIC
low complexity region 1275 1286 N/A INTRINSIC
low complexity region 1290 1312 N/A INTRINSIC
internal_repeat_2 1313 1485 6.34e-6 PROSPERO
low complexity region 1493 1525 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
low complexity region 1559 1720 N/A INTRINSIC
low complexity region 1734 1919 N/A INTRINSIC
low complexity region 1926 1951 N/A INTRINSIC
low complexity region 1966 1980 N/A INTRINSIC
low complexity region 2079 2105 N/A INTRINSIC
internal_repeat_3 2107 2118 1.06e-5 PROSPERO
internal_repeat_3 2135 2146 1.06e-5 PROSPERO
low complexity region 2153 2172 N/A INTRINSIC
internal_repeat_5 2182 2320 2.93e-5 PROSPERO
internal_repeat_1 2224 2368 3.81e-6 PROSPERO
low complexity region 2390 2425 N/A INTRINSIC
low complexity region 2518 2539 N/A INTRINSIC
low complexity region 2541 2550 N/A INTRINSIC
low complexity region 2552 2571 N/A INTRINSIC
low complexity region 2594 2607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175240
Predicted Effect probably benign
Transcript: ENSMUST00000186259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190568
Predicted Effect unknown
Transcript: ENSMUST00000190686
AA Change: S1613T
SMART Domains Protein: ENSMUSP00000139842
Gene: ENSMUSG00000039218
AA Change: S1613T

DomainStartEndE-ValueType
Pfam:cwf21 58 102 1.5e-13 PFAM
low complexity region 178 253 N/A INTRINSIC
low complexity region 257 284 N/A INTRINSIC
low complexity region 319 334 N/A INTRINSIC
internal_repeat_4 344 401 3.07e-5 PROSPERO
internal_repeat_5 355 484 3.07e-5 PROSPERO
low complexity region 503 519 N/A INTRINSIC
CTD 560 680 5.25e-14 SMART
low complexity region 748 778 N/A INTRINSIC
low complexity region 785 817 N/A INTRINSIC
internal_repeat_6 828 874 5.11e-5 PROSPERO
low complexity region 875 891 N/A INTRINSIC
low complexity region 898 920 N/A INTRINSIC
low complexity region 935 949 N/A INTRINSIC
internal_repeat_2 955 1220 6.62e-6 PROSPERO
internal_repeat_1 1151 1279 3.97e-6 PROSPERO
internal_repeat_4 1209 1262 3.07e-5 PROSPERO
internal_repeat_6 1265 1309 5.11e-5 PROSPERO
low complexity region 1332 1340 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
low complexity region 1386 1408 N/A INTRINSIC
internal_repeat_2 1409 1581 6.62e-6 PROSPERO
low complexity region 1589 1621 N/A INTRINSIC
low complexity region 1641 1651 N/A INTRINSIC
low complexity region 1655 1816 N/A INTRINSIC
low complexity region 1830 2015 N/A INTRINSIC
low complexity region 2022 2047 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
low complexity region 2175 2201 N/A INTRINSIC
internal_repeat_3 2203 2214 1.1e-5 PROSPERO
internal_repeat_3 2231 2242 1.1e-5 PROSPERO
low complexity region 2249 2268 N/A INTRINSIC
internal_repeat_5 2278 2416 3.07e-5 PROSPERO
internal_repeat_1 2320 2464 3.97e-6 PROSPERO
low complexity region 2486 2521 N/A INTRINSIC
low complexity region 2614 2635 N/A INTRINSIC
low complexity region 2637 2646 N/A INTRINSIC
low complexity region 2648 2667 N/A INTRINSIC
low complexity region 2690 2703 N/A INTRINSIC
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 96% (79/82)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449E01Rik T C 14: 105,498,946 noncoding transcript Het
Abca8b A T 11: 109,949,888 probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Anln A G 9: 22,350,918 probably null Het
Anpep T G 7: 79,835,417 Q607P probably benign Het
Arl13b A C 16: 62,813,277 probably null Het
Asxl3 T C 18: 22,516,987 S678P probably damaging Het
Atf6b C T 17: 34,647,728 Q58* probably null Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Cfap46 T A 7: 139,652,810 M782L probably benign Het
Cngb3 T C 4: 19,364,260 S155P probably benign Het
Coro1a T C 7: 126,701,547 I162V probably benign Het
Cry1 T A 10: 85,146,454 I343F probably damaging Het
Csnk1e A T 15: 79,424,850 M292K probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cul9 A T 17: 46,525,892 M1069K probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dnah11 T C 12: 118,015,465 I2633V probably damaging Het
Eif4g3 C A 4: 138,206,058 D1731E probably damaging Het
Epb41l4b T C 4: 57,032,204 T592A probably benign Het
Evi5 T C 5: 107,799,118 probably benign Het
Exo1 T A 1: 175,901,386 M672K probably benign Het
Fcho1 T C 8: 71,710,403 S661G probably damaging Het
Fnip2 A G 3: 79,508,168 Y188H possibly damaging Het
Foxb1 T C 9: 69,760,011 D79G probably damaging Het
Fyco1 T C 9: 123,829,281 Y610C probably damaging Het
Gm3095 C A 14: 3,964,571 N96K probably damaging Het
Gm3095 T A 14: 3,964,572 Y97N probably damaging Het
Gmfb A T 14: 46,811,780 L128* probably null Het
Gprc5c T A 11: 114,864,394 V299D possibly damaging Het
Hsfy2 C T 1: 56,637,229 V50I probably benign Het
Hspa12b A C 2: 131,140,929 K236Q probably benign Het
Impg2 A G 16: 56,259,858 Y566C probably damaging Het
Itpr3 A C 17: 27,116,607 probably null Het
Kprp G A 3: 92,825,476 T89I probably damaging Het
Lcmt2 T C 2: 121,138,652 E650G probably damaging Het
Lrch1 T C 14: 74,813,704 D331G probably damaging Het
Mroh9 T A 1: 163,024,541 I860F probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myt1l A G 12: 29,827,397 D349G unknown Het
Ndufs2 T C 1: 171,246,121 T31A probably benign Het
Ndufs3 A T 2: 90,898,672 S157T probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Noct T A 3: 51,247,830 S6R probably damaging Het
Npas2 T A 1: 39,300,727 H119Q probably damaging Het
Olfr1076 T G 2: 86,508,849 L130R probably damaging Het
Olfr1206 A G 2: 88,865,527 probably null Het
Olfr138 G A 17: 38,275,666 probably null Het
Oprl1 A T 2: 181,718,853 Y207F probably benign Het
Palm3 G T 8: 84,029,662 S601I possibly damaging Het
Plscr1 T A 9: 92,266,495 C163S probably damaging Het
Ptprk A T 10: 28,493,170 M713L probably benign Het
Rdm1 A G 11: 101,628,391 D72G possibly damaging Het
Reln T C 5: 22,060,368 D442G probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sbno1 T C 5: 124,404,216 Y338C probably damaging Het
Seh1l T G 18: 67,788,736 V222G probably damaging Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Slc25a18 A C 6: 120,786,342 probably benign Het
Slc33a1 T C 3: 63,948,229 T332A possibly damaging Het
Slc35d3 A G 10: 19,849,163 S316P probably benign Het
Spata48 A G 11: 11,488,641 probably benign Het
Srsf12 C T 4: 33,230,974 S156L probably damaging Het
Syce3 A G 15: 89,390,403 M49T probably benign Het
Tjp3 T C 10: 81,276,260 probably benign Het
Tnks G T 8: 34,875,276 N373K probably damaging Het
Togaram1 A G 12: 64,967,073 N366S possibly damaging Het
Trpm1 G A 7: 64,240,535 R962H probably damaging Het
Trpm6 A T 19: 18,877,631 M1885L possibly damaging Het
Tshz3 A G 7: 36,771,796 D1070G probably damaging Het
Ush2a T C 1: 188,814,224 M3399T probably benign Het
Utp15 G A 13: 98,257,187 T196I probably benign Het
Vmn1r168 T C 7: 23,541,300 I194T probably benign Het
Vmn2r73 C T 7: 85,875,912 W9* probably null Het
Wdr17 T C 8: 54,639,895 Y1076C probably damaging Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zbtb46 A T 2: 181,424,249 V36E possibly damaging Het
Zfp558 T C 9: 18,469,283 I9M possibly damaging Het
Zscan2 T A 7: 80,875,786 Y418* probably null Het
Other mutations in Srrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Srrm2 APN 17 23812478 missense probably benign 0.23
IGL00484:Srrm2 APN 17 23818518 missense probably benign 0.23
IGL01413:Srrm2 APN 17 23816025 unclassified probably benign
IGL02272:Srrm2 APN 17 23815782 unclassified probably benign
IGL02279:Srrm2 APN 17 23815332 unclassified probably benign
IGL02325:Srrm2 APN 17 23810479 unclassified probably benign
IGL02947:Srrm2 APN 17 23810746 missense probably benign 0.23
IGL03002:Srrm2 APN 17 23815734 unclassified probably benign
R0173:Srrm2 UTSW 17 23815129 unclassified probably benign
R1018:Srrm2 UTSW 17 23822540 missense probably damaging 0.98
R1109:Srrm2 UTSW 17 23819617 unclassified probably benign
R1199:Srrm2 UTSW 17 23817751 unclassified probably benign
R1471:Srrm2 UTSW 17 23820796 missense probably damaging 1.00
R1478:Srrm2 UTSW 17 23815902 missense probably benign 0.23
R1678:Srrm2 UTSW 17 23818986 missense probably benign 0.23
R1853:Srrm2 UTSW 17 23820525 missense probably damaging 1.00
R1968:Srrm2 UTSW 17 23821491 missense probably damaging 1.00
R2094:Srrm2 UTSW 17 23812429 unclassified probably benign
R2102:Srrm2 UTSW 17 23817748 unclassified probably benign
R2156:Srrm2 UTSW 17 23818263 missense probably benign 0.23
R2214:Srrm2 UTSW 17 23816745 unclassified probably benign
R2913:Srrm2 UTSW 17 23815684 unclassified probably benign
R3721:Srrm2 UTSW 17 23822575 small deletion probably benign
R4411:Srrm2 UTSW 17 23810468 unclassified probably benign
R4412:Srrm2 UTSW 17 23810468 unclassified probably benign
R4413:Srrm2 UTSW 17 23810468 unclassified probably benign
R4583:Srrm2 UTSW 17 23819619 unclassified probably benign
R4682:Srrm2 UTSW 17 23815692 missense probably benign 0.23
R4910:Srrm2 UTSW 17 23815388 unclassified probably benign
R4943:Srrm2 UTSW 17 23822415 missense possibly damaging 0.94
R5023:Srrm2 UTSW 17 23819317 unclassified probably benign
R5033:Srrm2 UTSW 17 23820618 missense probably damaging 1.00
R5163:Srrm2 UTSW 17 23819550 unclassified probably benign
R5186:Srrm2 UTSW 17 23816587 missense probably benign 0.23
R5197:Srrm2 UTSW 17 23817384 missense probably benign 0.23
R5366:Srrm2 UTSW 17 23818704 missense probably benign 0.23
R5483:Srrm2 UTSW 17 23821272 missense probably damaging 0.96
R5551:Srrm2 UTSW 17 23818476 unclassified probably benign
R5602:Srrm2 UTSW 17 23819337 unclassified probably benign
R5733:Srrm2 UTSW 17 23821386 missense probably damaging 0.98
R5774:Srrm2 UTSW 17 23818275 unclassified probably benign
R5909:Srrm2 UTSW 17 23821317 missense probably benign 0.27
R5961:Srrm2 UTSW 17 23820109 unclassified probably benign
R6122:Srrm2 UTSW 17 23820356 missense possibly damaging 0.58
R6906:Srrm2 UTSW 17 23820363 missense probably damaging 0.97
R7084:Srrm2 UTSW 17 23820316 missense probably damaging 0.99
R7177:Srrm2 UTSW 17 23816773 missense unknown
R7197:Srrm2 UTSW 17 23818224 missense unknown
R7442:Srrm2 UTSW 17 23820117 missense unknown
R7644:Srrm2 UTSW 17 23819320 missense unknown
R7664:Srrm2 UTSW 17 23820981 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTTGACAGCAAATCTCGACACTC -3'
(R):5'- ACTGAAGGACTTCTTCTGCGTCTTG -3'

Sequencing Primer
(F):5'- GCTCAGTAGGTCTGGCTCATC -3'
(R):5'- AGCGGATTTCTGGTGATGAG -3'
Posted On2014-04-24