Incidental Mutation 'R1618:Cul9'
ID174478
Institutional Source Beutler Lab
Gene Symbol Cul9
Ensembl Gene ENSMUSG00000040327
Gene Namecullin 9
Synonyms1810035I07Rik, Parc
MMRRC Submission 039655-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R1618 (G1)
Quality Score162
Status Validated
Chromosome17
Chromosomal Location46500572-46546388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46525892 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1069 (M1069K)
Ref Sequence ENSEMBL: ENSMUSP00000138418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066026] [ENSMUST00000182485]
Predicted Effect probably benign
Transcript: ENSMUST00000066026
AA Change: M1069K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327
AA Change: M1069K

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 441 1e-35 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 2e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
low complexity region 2503 2520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182451
Predicted Effect probably benign
Transcript: ENSMUST00000182485
AA Change: M1069K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327
AA Change: M1069K

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 442 1.4e-33 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 3e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
coiled coil region 2461 2497 N/A INTRINSIC
low complexity region 2513 2530 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183163
Meta Mutation Damage Score 0.1617 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 96% (79/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449E01Rik T C 14: 105,498,946 noncoding transcript Het
Abca8b A T 11: 109,949,888 probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Anln A G 9: 22,350,918 probably null Het
Anpep T G 7: 79,835,417 Q607P probably benign Het
Arl13b A C 16: 62,813,277 probably null Het
Asxl3 T C 18: 22,516,987 S678P probably damaging Het
Atf6b C T 17: 34,647,728 Q58* probably null Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Cfap46 T A 7: 139,652,810 M782L probably benign Het
Cngb3 T C 4: 19,364,260 S155P probably benign Het
Coro1a T C 7: 126,701,547 I162V probably benign Het
Cry1 T A 10: 85,146,454 I343F probably damaging Het
Csnk1e A T 15: 79,424,850 M292K probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dnah11 T C 12: 118,015,465 I2633V probably damaging Het
Eif4g3 C A 4: 138,206,058 D1731E probably damaging Het
Epb41l4b T C 4: 57,032,204 T592A probably benign Het
Evi5 T C 5: 107,799,118 probably benign Het
Exo1 T A 1: 175,901,386 M672K probably benign Het
Fcho1 T C 8: 71,710,403 S661G probably damaging Het
Fnip2 A G 3: 79,508,168 Y188H possibly damaging Het
Foxb1 T C 9: 69,760,011 D79G probably damaging Het
Fyco1 T C 9: 123,829,281 Y610C probably damaging Het
Gm3095 C A 14: 3,964,571 N96K probably damaging Het
Gm3095 T A 14: 3,964,572 Y97N probably damaging Het
Gmfb A T 14: 46,811,780 L128* probably null Het
Gprc5c T A 11: 114,864,394 V299D possibly damaging Het
Hsfy2 C T 1: 56,637,229 V50I probably benign Het
Hspa12b A C 2: 131,140,929 K236Q probably benign Het
Impg2 A G 16: 56,259,858 Y566C probably damaging Het
Itpr3 A C 17: 27,116,607 probably null Het
Kprp G A 3: 92,825,476 T89I probably damaging Het
Lcmt2 T C 2: 121,138,652 E650G probably damaging Het
Lrch1 T C 14: 74,813,704 D331G probably damaging Het
Mroh9 T A 1: 163,024,541 I860F probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myt1l A G 12: 29,827,397 D349G unknown Het
Ndufs2 T C 1: 171,246,121 T31A probably benign Het
Ndufs3 A T 2: 90,898,672 S157T probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Noct T A 3: 51,247,830 S6R probably damaging Het
Npas2 T A 1: 39,300,727 H119Q probably damaging Het
Olfr1076 T G 2: 86,508,849 L130R probably damaging Het
Olfr1206 A G 2: 88,865,527 probably null Het
Olfr138 G A 17: 38,275,666 probably null Het
Oprl1 A T 2: 181,718,853 Y207F probably benign Het
Palm3 G T 8: 84,029,662 S601I possibly damaging Het
Plscr1 T A 9: 92,266,495 C163S probably damaging Het
Ptprk A T 10: 28,493,170 M713L probably benign Het
Rdm1 A G 11: 101,628,391 D72G possibly damaging Het
Reln T C 5: 22,060,368 D442G probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sbno1 T C 5: 124,404,216 Y338C probably damaging Het
Seh1l T G 18: 67,788,736 V222G probably damaging Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Slc25a18 A C 6: 120,786,342 probably benign Het
Slc33a1 T C 3: 63,948,229 T332A possibly damaging Het
Slc35d3 A G 10: 19,849,163 S316P probably benign Het
Spata48 A G 11: 11,488,641 probably benign Het
Srrm2 T A 17: 23,818,932 probably benign Het
Srsf12 C T 4: 33,230,974 S156L probably damaging Het
Syce3 A G 15: 89,390,403 M49T probably benign Het
Tjp3 T C 10: 81,276,260 probably benign Het
Tnks G T 8: 34,875,276 N373K probably damaging Het
Togaram1 A G 12: 64,967,073 N366S possibly damaging Het
Trpm1 G A 7: 64,240,535 R962H probably damaging Het
Trpm6 A T 19: 18,877,631 M1885L possibly damaging Het
Tshz3 A G 7: 36,771,796 D1070G probably damaging Het
Ush2a T C 1: 188,814,224 M3399T probably benign Het
Utp15 G A 13: 98,257,187 T196I probably benign Het
Vmn1r168 T C 7: 23,541,300 I194T probably benign Het
Vmn2r73 C T 7: 85,875,912 W9* probably null Het
Wdr17 T C 8: 54,639,895 Y1076C probably damaging Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zbtb46 A T 2: 181,424,249 V36E possibly damaging Het
Zfp558 T C 9: 18,469,283 I9M possibly damaging Het
Zscan2 T A 7: 80,875,786 Y418* probably null Het
Other mutations in Cul9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cul9 APN 17 46525709 missense probably damaging 1.00
IGL00330:Cul9 APN 17 46510841 splice site probably benign
IGL00726:Cul9 APN 17 46528096 missense probably damaging 1.00
IGL01020:Cul9 APN 17 46539023 missense probably damaging 1.00
IGL01358:Cul9 APN 17 46538314 missense probably damaging 1.00
IGL01410:Cul9 APN 17 46528646 missense probably damaging 0.99
IGL01781:Cul9 APN 17 46539304 missense probably benign
IGL01873:Cul9 APN 17 46502452 missense probably damaging 0.99
IGL02117:Cul9 APN 17 46540375 missense probably benign 0.00
IGL02300:Cul9 APN 17 46521032 splice site probably benign
IGL02426:Cul9 APN 17 46523258 missense possibly damaging 0.95
IGL02427:Cul9 APN 17 46502632 missense possibly damaging 0.69
IGL02496:Cul9 APN 17 46540376 missense possibly damaging 0.72
IGL03008:Cul9 APN 17 46502697 splice site probably benign
IGL03059:Cul9 APN 17 46538987 missense probably damaging 0.98
IGL03302:Cul9 APN 17 46526640 missense probably damaging 0.98
bottlenose UTSW 17 46500844 missense possibly damaging 0.79
flipper UTSW 17 46525892 missense probably benign 0.05
orca UTSW 17 46525135 missense probably damaging 1.00
FR4340:Cul9 UTSW 17 46500853 small insertion probably benign
FR4449:Cul9 UTSW 17 46500856 small insertion probably benign
FR4737:Cul9 UTSW 17 46500846 small insertion probably benign
FR4737:Cul9 UTSW 17 46500858 small insertion probably benign
FR4976:Cul9 UTSW 17 46500848 small insertion probably benign
FR4976:Cul9 UTSW 17 46500850 small insertion probably benign
FR4976:Cul9 UTSW 17 46500853 small insertion probably benign
FR4976:Cul9 UTSW 17 46500856 small insertion probably benign
R0012:Cul9 UTSW 17 46538510 missense probably benign 0.26
R0079:Cul9 UTSW 17 46537663 nonsense probably null
R0143:Cul9 UTSW 17 46526410 missense possibly damaging 0.65
R0390:Cul9 UTSW 17 46528589 missense probably benign 0.34
R0401:Cul9 UTSW 17 46541704 missense probably damaging 1.00
R0529:Cul9 UTSW 17 46520468 splice site probably benign
R0815:Cul9 UTSW 17 46537822 splice site probably null
R0863:Cul9 UTSW 17 46537822 splice site probably null
R0972:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1173:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1216:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1217:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1261:Cul9 UTSW 17 46525782 missense probably damaging 1.00
R1278:Cul9 UTSW 17 46500849 small deletion probably benign
R1281:Cul9 UTSW 17 46511534 missense probably damaging 1.00
R1349:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1372:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1482:Cul9 UTSW 17 46508547 missense probably damaging 0.99
R1491:Cul9 UTSW 17 46538564 nonsense probably null
R1641:Cul9 UTSW 17 46543560 missense possibly damaging 0.96
R1679:Cul9 UTSW 17 46521156 missense possibly damaging 0.90
R1771:Cul9 UTSW 17 46537812 missense probably benign 0.41
R1803:Cul9 UTSW 17 46503097 missense probably damaging 1.00
R2020:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R2046:Cul9 UTSW 17 46543733 missense probably damaging 1.00
R2056:Cul9 UTSW 17 46543372 missense probably benign
R2088:Cul9 UTSW 17 46526649 missense probably damaging 1.00
R2415:Cul9 UTSW 17 46543438 missense probably benign
R2925:Cul9 UTSW 17 46510981 missense probably benign 0.08
R2964:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R2965:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R3690:Cul9 UTSW 17 46504031 splice site probably null
R3847:Cul9 UTSW 17 46525135 missense probably damaging 1.00
R4437:Cul9 UTSW 17 46502159 missense probably damaging 1.00
R4470:Cul9 UTSW 17 46538336 missense probably benign 0.00
R4540:Cul9 UTSW 17 46503089 missense probably null 0.98
R4555:Cul9 UTSW 17 46501829 missense possibly damaging 0.82
R4604:Cul9 UTSW 17 46530146 missense probably damaging 0.99
R4646:Cul9 UTSW 17 46539017 nonsense probably null
R4799:Cul9 UTSW 17 46500844 missense possibly damaging 0.79
R4822:Cul9 UTSW 17 46530051 missense probably benign 0.01
R4964:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R4965:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R5027:Cul9 UTSW 17 46500782 missense probably damaging 0.99
R5185:Cul9 UTSW 17 46525832 missense possibly damaging 0.95
R5237:Cul9 UTSW 17 46543467 missense probably benign 0.00
R5278:Cul9 UTSW 17 46510873 missense probably damaging 1.00
R5361:Cul9 UTSW 17 46500849 small deletion probably benign
R5455:Cul9 UTSW 17 46510846 splice site probably null
R5592:Cul9 UTSW 17 46520591 missense probably benign 0.00
R5597:Cul9 UTSW 17 46502665 missense possibly damaging 0.56
R5613:Cul9 UTSW 17 46503844 missense probably damaging 1.00
R6122:Cul9 UTSW 17 46521928 missense possibly damaging 0.72
R6135:Cul9 UTSW 17 46521453 missense probably benign
R6352:Cul9 UTSW 17 46511315 missense probably benign 0.00
R6376:Cul9 UTSW 17 46508563 missense probably damaging 1.00
R6868:Cul9 UTSW 17 46522183 missense possibly damaging 0.73
R6898:Cul9 UTSW 17 46511026 missense possibly damaging 0.87
R7090:Cul9 UTSW 17 46500839 missense probably damaging 0.96
R7193:Cul9 UTSW 17 46538497 missense probably damaging 0.98
R7221:Cul9 UTSW 17 46528565 missense probably damaging 0.99
R7291:Cul9 UTSW 17 46540433 missense probably benign 0.00
R7320:Cul9 UTSW 17 46510909 missense possibly damaging 0.80
R7348:Cul9 UTSW 17 46510993 missense possibly damaging 0.89
R7463:Cul9 UTSW 17 46520476 splice site probably null
R7480:Cul9 UTSW 17 46537812 missense probably benign 0.41
R7573:Cul9 UTSW 17 46519910 missense probably benign
R7582:Cul9 UTSW 17 46510979 missense probably damaging 1.00
R7605:Cul9 UTSW 17 46541732 missense probably damaging 0.99
R7684:Cul9 UTSW 17 46509889 missense probably damaging 1.00
R7830:Cul9 UTSW 17 46540311 missense probably benign 0.37
R7917:Cul9 UTSW 17 46525704 splice site probably null
RF011:Cul9 UTSW 17 46500848 small insertion probably benign
RF016:Cul9 UTSW 17 46500863 nonsense probably null
RF026:Cul9 UTSW 17 46500869 nonsense probably null
RF027:Cul9 UTSW 17 46500848 small insertion probably benign
RF030:Cul9 UTSW 17 46500869 small insertion probably benign
RF033:Cul9 UTSW 17 46500854 small insertion probably benign
RF039:Cul9 UTSW 17 46500854 small insertion probably benign
RF041:Cul9 UTSW 17 46500854 nonsense probably null
RF042:Cul9 UTSW 17 46540615 frame shift probably null
RF057:Cul9 UTSW 17 46500863 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAACCCTTCTCACCAAGTCCTGATG -3'
(R):5'- GGAAGAAGCCTGTGACACTACACC -3'

Sequencing Primer
(F):5'- AGATTTGCTGCCACTGCTG -3'
(R):5'- AGCTGACTCTGAGTCCCAG -3'
Posted On2014-04-24