Incidental Mutation 'R1619:Col19a1'
ID174484
Institutional Source Beutler Lab
Gene Symbol Col19a1
Ensembl Gene ENSMUSG00000026141
Gene Namecollagen, type XIX, alpha 1
Synonyms
MMRRC Submission 039656-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1619 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location24261890-24587472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24534091 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 200 (V200E)
Ref Sequence ENSEMBL: ENSMUSP00000110899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051344] [ENSMUST00000115244]
Predicted Effect unknown
Transcript: ENSMUST00000051344
AA Change: V200E
SMART Domains Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141
AA Change: V200E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 349 1e-9 PFAM
Pfam:Collagen 325 391 2.2e-10 PFAM
Pfam:Collagen 376 442 1.4e-8 PFAM
Pfam:Collagen 436 500 2.9e-9 PFAM
Pfam:Collagen 474 536 6.3e-10 PFAM
Pfam:Collagen 519 579 5.6e-10 PFAM
Pfam:Collagen 559 620 1.2e-8 PFAM
Pfam:Collagen 619 675 8.7e-11 PFAM
Pfam:Collagen 697 774 2.4e-8 PFAM
Pfam:Collagen 753 819 8.7e-10 PFAM
Pfam:Collagen 831 892 8.8e-12 PFAM
internal_repeat_2 905 943 3.52e-11 PROSPERO
internal_repeat_1 905 980 8.61e-26 PROSPERO
internal_repeat_2 947 982 3.52e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115244
AA Change: V200E
SMART Domains Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141
AA Change: V200E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 347 3.1e-9 PFAM
Pfam:Collagen 330 391 1.1e-9 PFAM
internal_repeat_4 455 492 1.88e-5 PROSPERO
Pfam:Collagen 519 579 2e-9 PFAM
Pfam:Collagen 559 620 4.9e-8 PFAM
Pfam:Collagen 619 675 3.5e-10 PFAM
low complexity region 723 741 N/A INTRINSIC
Pfam:Collagen 753 819 2.8e-9 PFAM
Pfam:Collagen 831 892 3.9e-11 PFAM
internal_repeat_2 905 943 1.18e-11 PROSPERO
internal_repeat_1 905 980 8.89e-27 PROSPERO
internal_repeat_2 947 982 1.18e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1048 1069 N/A INTRINSIC
low complexity region 1078 1115 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,055 H1537L probably damaging Het
Actg2 T A 6: 83,523,187 N116I probably damaging Het
Actn1 G A 12: 80,173,022 H692Y probably damaging Het
Adamts6 C T 13: 104,312,777 P36S probably benign Het
Agr3 G A 12: 35,947,859 probably null Het
Ank3 T C 10: 69,879,975 V500A probably damaging Het
BC051019 T A 7: 109,718,062 D141V probably damaging Het
Bco1 T C 8: 117,108,715 F135S probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc42 A G 11: 68,594,289 K210E probably damaging Het
Cckar A T 5: 53,700,067 W263R probably damaging Het
Cela2a A G 4: 141,825,941 probably null Het
Cep97 A T 16: 55,927,796 N90K probably damaging Het
Ces2g A T 8: 104,967,352 Q440L probably damaging Het
Chchd6 G T 6: 89,419,754 T225K possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chrna5 A G 9: 55,004,365 T46A probably benign Het
Col16a1 G A 4: 130,098,940 G1531S probably damaging Het
Csf2rb A G 15: 78,335,211 D2G probably damaging Het
Csmd3 G A 15: 47,949,950 S1062L probably damaging Het
Cul5 G T 9: 53,658,593 Q113K probably benign Het
Dmwd TAGCCTGGGAA TAGCCTGGGAAGCCTGGGAA 7: 19,081,034 probably benign Het
Dse T C 10: 34,153,234 D620G probably damaging Het
Dsg1c A G 18: 20,264,842 N33S probably benign Het
Epc2 G A 2: 49,549,978 V803I probably damaging Het
Erap1 T A 13: 74,671,381 H171Q probably damaging Het
Esrrb T C 12: 86,514,500 V336A possibly damaging Het
Fech A T 18: 64,462,118 W300R probably damaging Het
Fgd4 T C 16: 16,424,056 I635V possibly damaging Het
Galc A T 12: 98,234,304 N282K probably benign Het
Gpat2 A G 2: 127,428,717 Y95C probably benign Het
Grm2 T A 9: 106,647,471 I682F probably damaging Het
Hdac10 G T 15: 89,126,675 A241D probably damaging Het
Helz T A 11: 107,636,279 C182* probably null Het
Ift140 A G 17: 25,088,865 Y978C probably damaging Het
Intu T A 3: 40,697,631 C839* probably null Het
Jmjd1c T C 10: 67,219,875 V358A probably benign Het
Kif26b A G 1: 178,916,478 S1380G probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Lrrc2 T A 9: 110,960,973 S99R probably benign Het
Mrpl48 G A 7: 100,546,275 probably benign Het
Mup9 A G 4: 60,421,879 probably benign Het
Nap1l1 G A 10: 111,493,379 V285I possibly damaging Het
Nepro A G 16: 44,727,028 D36G probably benign Het
Nkain4 A G 2: 180,936,001 F187L probably damaging Het
Nobox A T 6: 43,307,467 C82S possibly damaging Het
Ntn4 C A 10: 93,644,734 Q70K probably damaging Het
Olfr1281 A G 2: 111,328,961 I181V probably benign Het
Olfr1484 T A 19: 13,585,614 F103L probably benign Het
Olfr385 A T 11: 73,589,292 W149R probably damaging Het
Olfr644 T C 7: 104,068,531 R167G probably damaging Het
Olfr71 A G 4: 43,706,292 I92T probably damaging Het
Olfr823 A G 10: 130,112,679 I37T possibly damaging Het
Pappa A G 4: 65,176,229 E497G probably damaging Het
Pard3 C A 8: 127,380,502 T569K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh10 A G 3: 45,380,312 N354D possibly damaging Het
Pdgfc T C 3: 81,174,887 V129A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Phf20l1 A T 15: 66,615,259 H407L possibly damaging Het
Phip A T 9: 82,871,449 D1747E probably benign Het
Pkd1l1 A G 11: 8,950,413 S43P probably damaging Het
Plekhg2 T C 7: 28,368,421 E202G probably damaging Het
Rapsn A G 2: 91,043,159 D270G possibly damaging Het
Rims2 A C 15: 39,506,986 S939R probably damaging Het
Ripor3 T C 2: 167,980,845 D932G probably damaging Het
Rtp2 A T 16: 23,930,671 W30R probably damaging Het
Scgb2b27 A T 7: 34,012,132 D97E probably benign Het
Slc25a46 T C 18: 31,583,489 N320S probably benign Het
Slc9b1 A G 3: 135,355,004 probably null Het
Socs4 T A 14: 47,290,283 M225K possibly damaging Het
Spata31d1a A T 13: 59,702,433 L627* probably null Het
Srcin1 A G 11: 97,525,481 L975P probably damaging Het
Stard3 T A 11: 98,376,609 probably null Het
Susd2 G T 10: 75,638,044 S572R possibly damaging Het
Tll1 C A 8: 64,056,273 A568S probably benign Het
Tmem132a C G 19: 10,861,698 G460A probably damaging Het
Trim62 A G 4: 128,909,488 K444E probably damaging Het
Trpm3 A G 19: 22,711,907 T67A probably damaging Het
Ttc6 T C 12: 57,737,668 M1841T possibly damaging Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Vmn2r38 C A 7: 9,075,533 V617L probably damaging Het
Xkr6 G A 14: 63,819,317 V226M probably benign Het
Zfp940 G A 7: 29,845,537 A315V possibly damaging Het
Zfr C A 15: 12,150,387 T480K possibly damaging Het
Other mutations in Col19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col19a1 APN 1 24561306 missense unknown
IGL00514:Col19a1 APN 1 24536932 missense unknown
IGL00756:Col19a1 APN 1 24322942 missense possibly damaging 0.85
IGL01408:Col19a1 APN 1 24306250 splice site probably benign
IGL01608:Col19a1 APN 1 24282545 missense probably damaging 1.00
IGL01664:Col19a1 APN 1 24561335 missense unknown
IGL01906:Col19a1 APN 1 24317429 missense probably damaging 1.00
IGL01916:Col19a1 APN 1 24534241 missense unknown
IGL02040:Col19a1 APN 1 24312045 critical splice donor site probably null
IGL02407:Col19a1 APN 1 24312372 splice site probably null
IGL02505:Col19a1 APN 1 24300584 splice site probably benign
IGL02606:Col19a1 APN 1 24534116 nonsense probably null
IGL02659:Col19a1 APN 1 24534034 missense unknown
IGL02815:Col19a1 APN 1 24285251 splice site probably null
IGL02880:Col19a1 APN 1 24325973 splice site probably benign
IGL02897:Col19a1 APN 1 24534098 missense unknown
IGL03102:Col19a1 APN 1 24328053 missense probably damaging 1.00
R0038:Col19a1 UTSW 1 24559744 missense unknown
R0109:Col19a1 UTSW 1 24559768 splice site probably null
R0124:Col19a1 UTSW 1 24526458 missense unknown
R0326:Col19a1 UTSW 1 24285051 critical splice donor site probably null
R0390:Col19a1 UTSW 1 24289655 splice site probably benign
R0675:Col19a1 UTSW 1 24575455 start gained probably benign
R0826:Col19a1 UTSW 1 24526386 missense unknown
R0948:Col19a1 UTSW 1 24296801 missense probably damaging 0.98
R1014:Col19a1 UTSW 1 24301273 critical splice donor site probably null
R1691:Col19a1 UTSW 1 24536941 missense unknown
R1878:Col19a1 UTSW 1 24317395 missense probably benign 0.40
R1901:Col19a1 UTSW 1 24536997 missense unknown
R1928:Col19a1 UTSW 1 24451754 splice site probably benign
R1940:Col19a1 UTSW 1 24264750 nonsense probably null
R2015:Col19a1 UTSW 1 24559753 missense unknown
R2571:Col19a1 UTSW 1 24374631 missense unknown
R2844:Col19a1 UTSW 1 24559681 missense unknown
R2845:Col19a1 UTSW 1 24559681 missense unknown
R3107:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R3861:Col19a1 UTSW 1 24326017 missense probably damaging 1.00
R3872:Col19a1 UTSW 1 24575327 splice site probably benign
R4180:Col19a1 UTSW 1 24270392 missense probably damaging 1.00
R4195:Col19a1 UTSW 1 24534052 missense unknown
R4196:Col19a1 UTSW 1 24534052 missense unknown
R4234:Col19a1 UTSW 1 24315395 splice site probably null
R4250:Col19a1 UTSW 1 24525645 missense unknown
R4396:Col19a1 UTSW 1 24510866 missense unknown
R4405:Col19a1 UTSW 1 24534109 missense unknown
R4450:Col19a1 UTSW 1 24322035 missense probably damaging 0.96
R4583:Col19a1 UTSW 1 24561329 missense unknown
R4980:Col19a1 UTSW 1 24526483 missense unknown
R5222:Col19a1 UTSW 1 24559640 splice site probably null
R5407:Col19a1 UTSW 1 24303494 missense probably damaging 0.99
R5439:Col19a1 UTSW 1 24293112 missense probably damaging 1.00
R5739:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5740:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5891:Col19a1 UTSW 1 24289725 missense probably damaging 1.00
R5996:Col19a1 UTSW 1 24328071 missense probably damaging 1.00
R6074:Col19a1 UTSW 1 24526483 missense unknown
R6152:Col19a1 UTSW 1 24374621 missense unknown
R6191:Col19a1 UTSW 1 24317393 missense probably damaging 1.00
R6236:Col19a1 UTSW 1 24279949 missense probably damaging 1.00
R6315:Col19a1 UTSW 1 24526452 missense unknown
R6709:Col19a1 UTSW 1 24282496 missense probably damaging 1.00
R6748:Col19a1 UTSW 1 24534070 missense unknown
R7098:Col19a1 UTSW 1 24526474 missense unknown
R7114:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R7292:Col19a1 UTSW 1 24530008 missense unknown
R7392:Col19a1 UTSW 1 24534034 missense unknown
R7478:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7480:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7481:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7512:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7618:Col19a1 UTSW 1 24322084 missense probably benign 0.07
R7698:Col19a1 UTSW 1 24312078 missense probably benign 0.09
R7711:Col19a1 UTSW 1 24530008 missense unknown
R7725:Col19a1 UTSW 1 24270444 missense possibly damaging 0.94
Z1088:Col19a1 UTSW 1 24279940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- acattctcagacccAGGAGTCACTG -3'
(R):5'- TGCCAGCATACTTGAATCAAGGCAC -3'

Sequencing Primer
(F):5'- gacccAGGAGTCACTGTTGTAAG -3'
(R):5'- TCAAGCCATACGAAGATGTTCTC -3'
Posted On2014-04-24