Incidental Mutation 'R1619:Lrp1b'
ID 174486
Institutional Source Beutler Lab
Gene Symbol Lrp1b
Ensembl Gene ENSMUSG00000049252
Gene Name low density lipoprotein-related protein 1B (deleted in tumors)
Synonyms 9630004P12Rik
MMRRC Submission 039656-MU
Accession Numbers

Genbank: NM_053011.2

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1619 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 40595246-42653624 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40697589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 116 (S116P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052550]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000052550
AA Change: S3885P
SMART Domains Protein: ENSMUSP00000054275
Gene: ENSMUSG00000049252
AA Change: S3885P

low complexity region 3 19 N/A INTRINSIC
low complexity region 35 46 N/A INTRINSIC
LDLa 62 102 2.97e-12 SMART
LDLa 107 146 1.31e-8 SMART
EGF 150 185 1.95e1 SMART
EGF_CA 186 225 8.37e-8 SMART
LY 256 300 4.06e1 SMART
LY 304 348 1.15e-5 SMART
LY 349 392 1.17e-11 SMART
LY 393 435 1.12e-8 SMART
LY 436 478 2.21e1 SMART
EGF 505 548 2.45e0 SMART
LY 579 621 1.32e-5 SMART
LY 622 665 1.88e-10 SMART
LY 668 717 1.47e-12 SMART
LY 718 760 5.78e-11 SMART
LY 761 802 1.45e0 SMART
EGF_like 828 865 4.55e1 SMART
LDLa 875 914 7.15e-15 SMART
LDLa 916 955 5.26e-13 SMART
LDLa 957 995 6.13e-14 SMART
LDLa 997 1035 6.47e-13 SMART
LDLa 1036 1075 1.76e-14 SMART
LDLa 1083 1121 2.29e-13 SMART
LDLa 1125 1164 3.36e-11 SMART
LDLa 1166 1206 2.57e-7 SMART
EGF 1206 1244 1.58e-3 SMART
EGF 1248 1284 4.56e0 SMART
LY 1311 1353 4.85e-4 SMART
LY 1358 1400 6.49e-14 SMART
LY 1401 1445 8.18e-11 SMART
LY 1446 1490 4.25e-9 SMART
LY 1492 1534 5.4e-2 SMART
EGF 1561 1601 9.41e-2 SMART
LY 1629 1671 3.03e-5 SMART
LY 1672 1716 1.22e-9 SMART
LY 1718 1756 1.02e-2 SMART
LY 1757 1798 8.25e-7 SMART
EGF 1868 1906 4.03e-1 SMART
LY 1933 1975 1.01e-1 SMART
LY 1976 2018 3.03e-14 SMART
LY 2019 2062 2.16e-10 SMART
LY 2063 2105 4.09e-11 SMART
LY 2107 2149 9.96e0 SMART
EGF 2177 2214 2.13e0 SMART
LY 2292 2334 6.96e-5 SMART
LY 2340 2385 1.07e-5 SMART
LY 2386 2428 1.1e-11 SMART
LY 2429 2470 4.78e-3 SMART
EGF 2498 2535 2.03e1 SMART
LDLa 2540 2580 1.1e-6 SMART
LDLa 2582 2619 1.72e-8 SMART
LDLa 2621 2658 2.45e-13 SMART
LDLa 2669 2707 6.53e-9 SMART
LDLa 2712 2749 7.97e-13 SMART
LDLa 2750 2789 1.22e-8 SMART
LDLa 2791 2832 3.07e-14 SMART
LDLa 2835 2873 7.32e-12 SMART
LDLa 2875 2917 1.85e-8 SMART
LDLa 2921 2958 4.76e-11 SMART
EGF_CA 2957 2998 1.79e-7 SMART
EGF_CA 2999 3039 1.85e-9 SMART
LY 3066 3111 2.58e-8 SMART
LY 3112 3152 1.22e-9 SMART
LY 3153 3196 8.84e-7 SMART
LY 3197 3237 3.22e-9 SMART
LY 3238 3279 1.04e-3 SMART
EGF 3307 3345 7.13e-2 SMART
LDLa 3347 3385 9.29e-14 SMART
LDLa 3387 3424 2.25e-12 SMART
LDLa 3426 3464 5.63e-13 SMART
LDLa 3466 3504 1.07e-13 SMART
LDLa 3506 3543 1.35e-15 SMART
EGF_like 3545 3581 2.8e1 SMART
LDLa 3545 3582 1.49e-12 SMART
LDLa 3583 3620 4.21e-12 SMART
LDLa 3624 3661 4.9e-13 SMART
LDLa 3662 3700 9.58e-16 SMART
LDLa 3704 3743 5.38e-10 SMART
LDLa 3745 3784 1.42e-9 SMART
LDLa 3792 3829 3.66e-12 SMART
EGF 3835 3874 3.71e0 SMART
EGF_CA 3875 3912 6.8e-8 SMART
LY 3987 4033 4.24e0 SMART
LY 4050 4093 4.46e-3 SMART
LY 4094 4136 1.73e-9 SMART
EGF 4206 4239 2.45e0 SMART
EGF 4247 4280 2.48e-1 SMART
EGF 4283 4316 1.49e-4 SMART
EGF 4319 4352 1.69e-3 SMART
EGF 4355 4388 1.18e1 SMART
EGF_like 4391 4423 6.67e1 SMART
EGF 4424 4458 1.61e0 SMART
transmembrane domain 4476 4498 N/A INTRINSIC
low complexity region 4499 4509 N/A INTRINSIC
low complexity region 4512 4523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134032
Predicted Effect unknown
Transcript: ENSMUST00000142546
AA Change: S116P
SMART Domains Protein: ENSMUSP00000117212
Gene: ENSMUSG00000049252
AA Change: S116P

LDLa 2 30 1.76e-2 SMART
EGF 36 75 3.71e0 SMART
EGF_CA 76 113 6.8e-8 SMART
LY 188 234 4.24e0 SMART
LY 251 294 4.46e-3 SMART
LY 295 337 1.73e-9 SMART
EGF 407 440 2.45e0 SMART
EGF 448 481 2.48e-1 SMART
EGF 484 517 1.49e-4 SMART
EGF 520 553 1.69e-3 SMART
EGF 556 589 1.18e1 SMART
EGF_like 592 624 6.67e1 SMART
EGF 625 659 1.61e0 SMART
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 700 710 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor family. These receptors play a wide variety of roles in normal cell function and development due to their interactions with multiple ligands. Disruption of this gene has been reported in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice appear normal, are fertile, have normal brain histology and function, normal plasma cholesterol and fasting triglycerides, and do not develop tumors. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(3) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,055 H1537L probably damaging Het
Actg2 T A 6: 83,523,187 N116I probably damaging Het
Actn1 G A 12: 80,173,022 H692Y probably damaging Het
Adamts6 C T 13: 104,312,777 P36S probably benign Het
Agr3 G A 12: 35,947,859 probably null Het
Ank3 T C 10: 69,879,975 V500A probably damaging Het
BC051019 T A 7: 109,718,062 D141V probably damaging Het
Bco1 T C 8: 117,108,715 F135S probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc42 A G 11: 68,594,289 K210E probably damaging Het
Cckar A T 5: 53,700,067 W263R probably damaging Het
Cela2a A G 4: 141,825,941 probably null Het
Cep97 A T 16: 55,927,796 N90K probably damaging Het
Ces2g A T 8: 104,967,352 Q440L probably damaging Het
Chchd6 G T 6: 89,419,754 T225K possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chrna5 A G 9: 55,004,365 T46A probably benign Het
Col16a1 G A 4: 130,098,940 G1531S probably damaging Het
Col19a1 A T 1: 24,534,091 V200E unknown Het
Csf2rb A G 15: 78,335,211 D2G probably damaging Het
Csmd3 G A 15: 47,949,950 S1062L probably damaging Het
Cul5 G T 9: 53,658,593 Q113K probably benign Het
Dmwd TAGCCTGGGAA TAGCCTGGGAAGCCTGGGAA 7: 19,081,034 probably benign Het
Dse T C 10: 34,153,234 D620G probably damaging Het
Dsg1c A G 18: 20,264,842 N33S probably benign Het
Epc2 G A 2: 49,549,978 V803I probably damaging Het
Erap1 T A 13: 74,671,381 H171Q probably damaging Het
Esrrb T C 12: 86,514,500 V336A possibly damaging Het
Fech A T 18: 64,462,118 W300R probably damaging Het
Fgd4 T C 16: 16,424,056 I635V possibly damaging Het
Galc A T 12: 98,234,304 N282K probably benign Het
Gpat2 A G 2: 127,428,717 Y95C probably benign Het
Grm2 T A 9: 106,647,471 I682F probably damaging Het
Hdac10 G T 15: 89,126,675 A241D probably damaging Het
Helz T A 11: 107,636,279 C182* probably null Het
Ift140 A G 17: 25,088,865 Y978C probably damaging Het
Intu T A 3: 40,697,631 C839* probably null Het
Jmjd1c T C 10: 67,219,875 V358A probably benign Het
Kif26b A G 1: 178,916,478 S1380G probably benign Het
Lrrc2 T A 9: 110,960,973 S99R probably benign Het
Mrpl48 G A 7: 100,546,275 probably benign Het
Mup9 A G 4: 60,421,879 probably benign Het
Nap1l1 G A 10: 111,493,379 V285I possibly damaging Het
Nepro A G 16: 44,727,028 D36G probably benign Het
Nkain4 A G 2: 180,936,001 F187L probably damaging Het
Nobox A T 6: 43,307,467 C82S possibly damaging Het
Ntn4 C A 10: 93,644,734 Q70K probably damaging Het
Olfr1281 A G 2: 111,328,961 I181V probably benign Het
Olfr1484 T A 19: 13,585,614 F103L probably benign Het
Olfr385 A T 11: 73,589,292 W149R probably damaging Het
Olfr644 T C 7: 104,068,531 R167G probably damaging Het
Olfr71 A G 4: 43,706,292 I92T probably damaging Het
Olfr823 A G 10: 130,112,679 I37T possibly damaging Het
Pappa A G 4: 65,176,229 E497G probably damaging Het
Pard3 C A 8: 127,380,502 T569K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh10 A G 3: 45,380,312 N354D possibly damaging Het
Pdgfc T C 3: 81,174,887 V129A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Phf20l1 A T 15: 66,615,259 H407L possibly damaging Het
Phip A T 9: 82,871,449 D1747E probably benign Het
Pkd1l1 A G 11: 8,950,413 S43P probably damaging Het
Plekhg2 T C 7: 28,368,421 E202G probably damaging Het
Rapsn A G 2: 91,043,159 D270G possibly damaging Het
Rims2 A C 15: 39,506,986 S939R probably damaging Het
Ripor3 T C 2: 167,980,845 D932G probably damaging Het
Rtp2 A T 16: 23,930,671 W30R probably damaging Het
Scgb2b27 A T 7: 34,012,132 D97E probably benign Het
Slc25a46 T C 18: 31,583,489 N320S probably benign Het
Slc9b1 A G 3: 135,355,004 probably null Het
Socs4 T A 14: 47,290,283 M225K possibly damaging Het
Spata31d1a A T 13: 59,702,433 L627* probably null Het
Srcin1 A G 11: 97,525,481 L975P probably damaging Het
Stard3 T A 11: 98,376,609 probably null Het
Susd2 G T 10: 75,638,044 S572R possibly damaging Het
Tll1 C A 8: 64,056,273 A568S probably benign Het
Tmem132a C G 19: 10,861,698 G460A probably damaging Het
Trim62 A G 4: 128,909,488 K444E probably damaging Het
Trpm3 A G 19: 22,711,907 T67A probably damaging Het
Ttc6 T C 12: 57,737,668 M1841T possibly damaging Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Vmn2r38 C A 7: 9,075,533 V617L probably damaging Het
Xkr6 G A 14: 63,819,317 V226M probably benign Het
Zfp940 G A 7: 29,845,537 A315V possibly damaging Het
Zfr C A 15: 12,150,387 T480K possibly damaging Het
Other mutations in Lrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lrp1b APN 2 41110861 missense probably damaging 1.00
IGL00543:Lrp1b APN 2 41468948 missense possibly damaging 0.69
IGL00578:Lrp1b APN 2 40679173 missense unknown
IGL01020:Lrp1b APN 2 40998247 missense probably damaging 1.00
IGL01092:Lrp1b APN 2 40750947 missense probably damaging 0.97
IGL01155:Lrp1b APN 2 41770935 missense probably benign 0.17
IGL01361:Lrp1b APN 2 41110751 splice site probably benign
IGL01377:Lrp1b APN 2 40601538 missense probably damaging 1.00
IGL01459:Lrp1b APN 2 40860714 missense probably damaging 0.97
IGL01473:Lrp1b APN 2 40611486 missense probably damaging 0.97
IGL01528:Lrp1b APN 2 40919182 missense probably damaging 0.99
IGL01536:Lrp1b APN 2 41110883 missense probably benign 0.01
IGL01564:Lrp1b APN 2 40677486 splice site probably benign
IGL01747:Lrp1b APN 2 40860685 missense probably damaging 1.00
IGL01764:Lrp1b APN 2 40697442 missense unknown
IGL01783:Lrp1b APN 2 41312572 missense probably damaging 1.00
IGL01802:Lrp1b APN 2 41511482 missense probably benign 0.07
IGL01826:Lrp1b APN 2 41449234 missense probably damaging 1.00
IGL01884:Lrp1b APN 2 41284213 nonsense probably null
IGL01908:Lrp1b APN 2 40702804 missense probably benign
IGL01935:Lrp1b APN 2 41268355 missense probably damaging 1.00
IGL01959:Lrp1b APN 2 41312527 missense probably damaging 0.99
IGL02010:Lrp1b APN 2 41468942 missense probably damaging 1.00
IGL02022:Lrp1b APN 2 41282160 missense probably damaging 1.00
IGL02028:Lrp1b APN 2 41511452 missense probably damaging 1.00
IGL02034:Lrp1b APN 2 41268370 nonsense probably null
IGL02043:Lrp1b APN 2 40697525 missense probably null 0.44
IGL02066:Lrp1b APN 2 41111079 nonsense probably null
IGL02085:Lrp1b APN 2 40889309 missense probably benign
IGL02137:Lrp1b APN 2 40730688 splice site probably benign
IGL02218:Lrp1b APN 2 41295672 missense probably benign 0.11
IGL02409:Lrp1b APN 2 41445196 missense possibly damaging 0.93
IGL02513:Lrp1b APN 2 41110753 critical splice donor site probably null
IGL02543:Lrp1b APN 2 40870401 missense possibly damaging 0.89
IGL02701:Lrp1b APN 2 41246017 missense possibly damaging 0.50
IGL02728:Lrp1b APN 2 40801398 missense probably benign 0.03
IGL02739:Lrp1b APN 2 41498215 missense probably damaging 1.00
IGL02748:Lrp1b APN 2 40702749 missense probably damaging 0.99
IGL02754:Lrp1b APN 2 40702794 missense probably benign 0.02
IGL02797:Lrp1b APN 2 41671057 missense
IGL02813:Lrp1b APN 2 40679217 critical splice acceptor site probably null
IGL02831:Lrp1b APN 2 41193591 missense probably damaging 1.00
IGL02869:Lrp1b APN 2 40701830 missense unknown
IGL02946:Lrp1b APN 2 41312559 missense probably damaging 1.00
IGL02952:Lrp1b APN 2 41506703 missense probably benign 0.33
IGL02958:Lrp1b APN 2 41302916 missense probably damaging 1.00
IGL02977:Lrp1b APN 2 40730735 missense probably damaging 1.00
IGL03001:Lrp1b APN 2 40927889 missense probably damaging 1.00
IGL03010:Lrp1b APN 2 42323606 missense possibly damaging 0.94
IGL03060:Lrp1b APN 2 40637753 missense probably benign 0.04
IGL03129:Lrp1b APN 2 41312466 splice site probably benign
IGL03166:Lrp1b APN 2 41111038 missense probably damaging 1.00
IGL03170:Lrp1b APN 2 40697444 missense unknown
IGL03195:Lrp1b APN 2 41471122 missense possibly damaging 0.95
IGL03224:Lrp1b APN 2 41471031 missense possibly damaging 0.92
IGL03251:Lrp1b APN 2 40600267 missense probably benign 0.20
IGL03281:Lrp1b APN 2 40725514 missense probably benign 0.01
IGL03295:Lrp1b APN 2 40678987 splice site probably null
IGL03340:Lrp1b APN 2 41468969 missense probably damaging 0.97
IGL03391:Lrp1b APN 2 41295641 missense possibly damaging 0.95
IGL03401:Lrp1b APN 2 41110778 missense probably benign 0.18
IGL03403:Lrp1b APN 2 40702824 missense probably benign 0.16
IGL03408:Lrp1b APN 2 40858582 missense probably damaging 0.97
Fetching UTSW 2 40879555 missense probably benign 0.00
Heiden UTSW 2 40637775 missense probably benign 0.00
hither UTSW 2 40702848 missense probably benign 0.00
Roeslein UTSW 2 40725907 missense probably damaging 1.00
I2288:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
I2289:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
LCD18:Lrp1b UTSW 2 42237562 intron probably benign
PIT4431001:Lrp1b UTSW 2 41004755 missense
PIT4585001:Lrp1b UTSW 2 41269204 missense
R0022:Lrp1b UTSW 2 40998038 splice site probably benign
R0022:Lrp1b UTSW 2 40998038 splice site probably benign
R0054:Lrp1b UTSW 2 40742817 missense probably benign 0.11
R0054:Lrp1b UTSW 2 40742817 missense probably benign 0.11
R0094:Lrp1b UTSW 2 41282030 unclassified probably benign
R0102:Lrp1b UTSW 2 41408985 splice site probably benign
R0123:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0128:Lrp1b UTSW 2 41511508 missense probably damaging 1.00
R0130:Lrp1b UTSW 2 41511508 missense probably damaging 1.00
R0134:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0135:Lrp1b UTSW 2 41269239 missense probably damaging 0.99
R0153:Lrp1b UTSW 2 41123019 missense possibly damaging 0.92
R0178:Lrp1b UTSW 2 40725907 missense probably damaging 1.00
R0225:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0242:Lrp1b UTSW 2 40998183 missense probably benign 0.01
R0242:Lrp1b UTSW 2 40998183 missense probably benign 0.01
R0312:Lrp1b UTSW 2 41282171 missense probably damaging 1.00
R0325:Lrp1b UTSW 2 40851711 missense probably damaging 1.00
R0330:Lrp1b UTSW 2 40701761 nonsense probably null
R0372:Lrp1b UTSW 2 40730798 missense probably benign 0.30
R0400:Lrp1b UTSW 2 40750914 missense probably benign 0.40
R0408:Lrp1b UTSW 2 40677591 missense probably damaging 1.00
R0498:Lrp1b UTSW 2 41458405 missense probably benign 0.19
R0563:Lrp1b UTSW 2 40750914 missense probably benign 0.40
R0569:Lrp1b UTSW 2 40889239 missense probably benign 0.11
R0622:Lrp1b UTSW 2 41728551 critical splice donor site probably null
R0682:Lrp1b UTSW 2 41295641 missense probably benign 0.01
R0727:Lrp1b UTSW 2 40750944 missense probably benign 0.40
R0747:Lrp1b UTSW 2 40870341 missense probably damaging 1.00
R0761:Lrp1b UTSW 2 41185935 missense probably damaging 0.99
R0905:Lrp1b UTSW 2 41284185 missense probably damaging 1.00
R0959:Lrp1b UTSW 2 41268354 missense possibly damaging 0.83
R1124:Lrp1b UTSW 2 40875051 missense probably damaging 1.00
R1158:Lrp1b UTSW 2 40677494 missense unknown
R1265:Lrp1b UTSW 2 41476654 missense probably damaging 1.00
R1276:Lrp1b UTSW 2 41728576 missense probably benign 0.35
R1277:Lrp1b UTSW 2 40725945 missense probably benign
R1282:Lrp1b UTSW 2 40860761 missense probably damaging 1.00
R1291:Lrp1b UTSW 2 41341895 missense probably benign 0.05
R1316:Lrp1b UTSW 2 40702804 missense probably benign
R1340:Lrp1b UTSW 2 40702794 missense probably benign 0.02
R1371:Lrp1b UTSW 2 40647153 missense probably damaging 1.00
R1415:Lrp1b UTSW 2 40629664 missense probably damaging 1.00
R1416:Lrp1b UTSW 2 40998216 missense probably damaging 1.00
R1417:Lrp1b UTSW 2 41004641 missense probably benign 0.14
R1465:Lrp1b UTSW 2 41111059 missense probably benign 0.00
R1465:Lrp1b UTSW 2 41111059 missense probably benign 0.00
R1467:Lrp1b UTSW 2 40657356 splice site probably benign
R1468:Lrp1b UTSW 2 40927829 critical splice donor site probably null
R1468:Lrp1b UTSW 2 40927829 critical splice donor site probably null
R1480:Lrp1b UTSW 2 40903389 missense probably damaging 1.00
R1488:Lrp1b UTSW 2 41502024 missense probably benign 0.01
R1496:Lrp1b UTSW 2 42323662 missense probably damaging 0.98
R1542:Lrp1b UTSW 2 41123712 missense probably damaging 1.00
R1571:Lrp1b UTSW 2 41476646 missense probably damaging 1.00
R1598:Lrp1b UTSW 2 41511478 missense probably damaging 1.00
R1697:Lrp1b UTSW 2 40822683 missense probably damaging 0.99
R1698:Lrp1b UTSW 2 40851806 nonsense probably null
R1699:Lrp1b UTSW 2 41185962 missense possibly damaging 0.91
R1715:Lrp1b UTSW 2 41185981 missense probably damaging 1.00
R1748:Lrp1b UTSW 2 41728706 missense possibly damaging 0.56
R1756:Lrp1b UTSW 2 41110825 missense probably damaging 1.00
R1889:Lrp1b UTSW 2 40919167 nonsense probably null
R1895:Lrp1b UTSW 2 40665147 missense unknown
R1902:Lrp1b UTSW 2 40860661 missense probably damaging 1.00
R1919:Lrp1b UTSW 2 41728729 missense probably benign 0.00
R1939:Lrp1b UTSW 2 40697589 missense unknown
R1946:Lrp1b UTSW 2 40665147 missense unknown
R1954:Lrp1b UTSW 2 40858441 missense probably damaging 1.00
R1970:Lrp1b UTSW 2 40875069 missense probably damaging 1.00
R1983:Lrp1b UTSW 2 41511404 critical splice donor site probably null
R2029:Lrp1b UTSW 2 41341849 missense probably benign 0.02
R2054:Lrp1b UTSW 2 40697482 missense unknown
R2108:Lrp1b UTSW 2 41110757 missense probably damaging 1.00
R2158:Lrp1b UTSW 2 40879555 missense probably benign 0.00
R2168:Lrp1b UTSW 2 41375846 missense probably damaging 1.00
R2184:Lrp1b UTSW 2 40730702 missense probably benign
R2188:Lrp1b UTSW 2 41408959 missense probably benign 0.25
R2200:Lrp1b UTSW 2 41284165 missense probably benign 0.43
R2342:Lrp1b UTSW 2 40919196 missense possibly damaging 0.89
R2421:Lrp1b UTSW 2 40882133 splice site probably benign
R2656:Lrp1b UTSW 2 41511581 missense probably damaging 0.99
R2864:Lrp1b UTSW 2 40874995 missense possibly damaging 0.92
R2874:Lrp1b UTSW 2 40851693 missense probably damaging 1.00
R2911:Lrp1b UTSW 2 41506692 missense probably benign 0.00
R2919:Lrp1b UTSW 2 41770899 missense probably damaging 1.00
R3027:Lrp1b UTSW 2 40870271 missense probably benign 0.33
R3083:Lrp1b UTSW 2 40600324 missense probably damaging 0.99
R3545:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3546:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3547:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3709:Lrp1b UTSW 2 40697442 missense unknown
R3817:Lrp1b UTSW 2 40876658 missense probably damaging 1.00
R3876:Lrp1b UTSW 2 41445194 missense probably damaging 1.00
R3877:Lrp1b UTSW 2 41445194 missense probably damaging 1.00
R3896:Lrp1b UTSW 2 40922428 splice site probably null
R3901:Lrp1b UTSW 2 40822695 missense probably damaging 1.00
R3915:Lrp1b UTSW 2 41449236 missense probably damaging 1.00
R3922:Lrp1b UTSW 2 40677581 missense unknown
R3964:Lrp1b UTSW 2 41312470 splice site probably benign
R4013:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4014:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4015:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4017:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4031:Lrp1b UTSW 2 40702848 missense probably benign 0.00
R4095:Lrp1b UTSW 2 41449191 missense probably benign 0.03
R4108:Lrp1b UTSW 2 40665087 missense unknown
R4176:Lrp1b UTSW 2 41408393 missense probably damaging 1.00
R4181:Lrp1b UTSW 2 40611434 missense probably damaging 1.00
R4359:Lrp1b UTSW 2 40903065 missense probably damaging 1.00
R4410:Lrp1b UTSW 2 40665082 missense possibly damaging 0.96
R4416:Lrp1b UTSW 2 40663667 missense unknown
R4489:Lrp1b UTSW 2 40661489 unclassified probably benign
R4577:Lrp1b UTSW 2 40821719 missense probably damaging 1.00
R4623:Lrp1b UTSW 2 41246021 missense probably damaging 1.00
R4677:Lrp1b UTSW 2 40801484 missense probably damaging 1.00
R4684:Lrp1b UTSW 2 40922304 missense probably benign 0.44
R4714:Lrp1b UTSW 2 41110759 missense possibly damaging 0.90
R4721:Lrp1b UTSW 2 40715369 splice site probably null
R4755:Lrp1b UTSW 2 41269273 missense probably benign 0.07
R4755:Lrp1b UTSW 2 41471016 missense probably benign
R4774:Lrp1b UTSW 2 40661532 missense probably null 1.00
R4854:Lrp1b UTSW 2 41111077 missense probably damaging 1.00
R4880:Lrp1b UTSW 2 41770919 missense probably benign 0.07
R4885:Lrp1b UTSW 2 41468893 missense probably benign
R4901:Lrp1b UTSW 2 40821645 missense probably damaging 1.00
R4919:Lrp1b UTSW 2 40647234 missense probably benign 0.25
R4935:Lrp1b UTSW 2 41498393 missense probably benign 0.01
R4937:Lrp1b UTSW 2 40802885 splice site probably null
R4967:Lrp1b UTSW 2 41788974 missense probably damaging 1.00
R4968:Lrp1b UTSW 2 40702707 splice site probably null
R4968:Lrp1b UTSW 2 41789062 missense probably damaging 1.00
R5155:Lrp1b UTSW 2 41728622 splice site probably null
R5221:Lrp1b UTSW 2 41112982 missense possibly damaging 0.79
R5224:Lrp1b UTSW 2 41110840 missense possibly damaging 0.61
R5227:Lrp1b UTSW 2 40851793 missense possibly damaging 0.95
R5246:Lrp1b UTSW 2 41470940 critical splice donor site probably null
R5263:Lrp1b UTSW 2 41960679 missense probably damaging 1.00
R5274:Lrp1b UTSW 2 41344444 missense probably null 1.00
R5291:Lrp1b UTSW 2 40903003 missense probably damaging 1.00
R5362:Lrp1b UTSW 2 41375902 missense probably damaging 1.00
R5365:Lrp1b UTSW 2 40647125 missense possibly damaging 0.55
R5369:Lrp1b UTSW 2 41004613 nonsense probably null
R5419:Lrp1b UTSW 2 40730704 nonsense probably null
R5434:Lrp1b UTSW 2 41770868 missense probably damaging 0.96
R5452:Lrp1b UTSW 2 40922316 missense probably damaging 1.00
R5453:Lrp1b UTSW 2 41282237 missense probably damaging 1.00
R5496:Lrp1b UTSW 2 40927973 missense probably benign 0.02
R5524:Lrp1b UTSW 2 41110888 missense probably damaging 1.00
R5538:Lrp1b UTSW 2 40697474 missense unknown
R5571:Lrp1b UTSW 2 41408342 missense probably damaging 0.97
R5577:Lrp1b UTSW 2 40875123 missense possibly damaging 0.70
R5609:Lrp1b UTSW 2 41341795 missense probably damaging 1.00
R5635:Lrp1b UTSW 2 42652822 utr 5 prime probably benign
R5669:Lrp1b UTSW 2 41111038 missense probably damaging 1.00
R5672:Lrp1b UTSW 2 41341759 missense probably benign 0.01
R5690:Lrp1b UTSW 2 40750894 splice site probably null
R5752:Lrp1b UTSW 2 41295612 missense probably damaging 1.00
R5853:Lrp1b UTSW 2 40663726 missense unknown
R5869:Lrp1b UTSW 2 41004603 missense probably damaging 0.98
R5880:Lrp1b UTSW 2 41341814 missense probably benign 0.23
R5887:Lrp1b UTSW 2 40821707 missense possibly damaging 0.91
R5893:Lrp1b UTSW 2 40601587 missense probably damaging 1.00
R5894:Lrp1b UTSW 2 41498221 missense probably benign 0.11
R6019:Lrp1b UTSW 2 41302970 missense probably damaging 1.00
R6019:Lrp1b UTSW 2 41476809 missense probably damaging 1.00
R6021:Lrp1b UTSW 2 41344427 missense probably benign 0.02
R6045:Lrp1b UTSW 2 40701813 missense unknown
R6047:Lrp1b UTSW 2 40637775 missense probably benign 0.00
R6060:Lrp1b UTSW 2 40750934 missense
R6063:Lrp1b UTSW 2 41284144 nonsense probably null
R6090:Lrp1b UTSW 2 41185868 critical splice donor site probably null
R6112:Lrp1b UTSW 2 41341882 missense probably benign 0.14
R6128:Lrp1b UTSW 2 40860655 missense probably benign
R6149:Lrp1b UTSW 2 40875153 splice site probably null
R6174:Lrp1b UTSW 2 41449263 missense probably benign
R6177:Lrp1b UTSW 2 41123736 splice site probably null
R6257:Lrp1b UTSW 2 40596969 splice site probably null
R6267:Lrp1b UTSW 2 40657525 missense probably benign 0.00
R6268:Lrp1b UTSW 2 40821717 missense probably benign 0.01
R6331:Lrp1b UTSW 2 40803209 missense probably damaging 1.00
R6334:Lrp1b UTSW 2 41789033 missense probably benign
R6359:Lrp1b UTSW 2 41295596 missense probably damaging 1.00
R6371:Lrp1b UTSW 2 40851654 missense possibly damaging 0.61
R6421:Lrp1b UTSW 2 40889270 missense probably damaging 1.00
R6524:Lrp1b UTSW 2 40851804 missense possibly damaging 0.95
R6616:Lrp1b UTSW 2 40699631 missense unknown
R6632:Lrp1b UTSW 2 40725442 missense probably benign 0.23
R6656:Lrp1b UTSW 2 40637864 nonsense probably null
R6698:Lrp1b UTSW 2 41302946 missense probably damaging 1.00
R6741:Lrp1b UTSW 2 41245989 missense possibly damaging 0.82
R6742:Lrp1b UTSW 2 41471120 missense probably benign 0.31
R6811:Lrp1b UTSW 2 40715500 splice site probably null
R6811:Lrp1b UTSW 2 41449194 missense probably benign 0.01
R6855:Lrp1b UTSW 2 40628696 missense possibly damaging 0.66
R6888:Lrp1b UTSW 2 41471126 missense probably benign 0.18
R6946:Lrp1b UTSW 2 40697439 missense probably benign
R6984:Lrp1b UTSW 2 40822628 missense probably damaging 0.97
R7026:Lrp1b UTSW 2 41269222 missense probably damaging 1.00
R7028:Lrp1b UTSW 2 41246011 missense probably benign 0.45
R7036:Lrp1b UTSW 2 41112342 missense possibly damaging 0.89
R7043:Lrp1b UTSW 2 40922414 missense possibly damaging 0.84
R7071:Lrp1b UTSW 2 41408264 missense
R7077:Lrp1b UTSW 2 41770846 missense
R7115:Lrp1b UTSW 2 40998235 missense
R7143:Lrp1b UTSW 2 41312643 missense
R7146:Lrp1b UTSW 2 41375994 nonsense probably null
R7149:Lrp1b UTSW 2 40637860 missense
R7185:Lrp1b UTSW 2 40801512 critical splice acceptor site probably null
R7239:Lrp1b UTSW 2 41004713 missense
R7247:Lrp1b UTSW 2 41269212 missense
R7331:Lrp1b UTSW 2 40663610 splice site probably null
R7369:Lrp1b UTSW 2 41282039 missense
R7378:Lrp1b UTSW 2 41295669 missense
R7381:Lrp1b UTSW 2 40802917 missense
R7406:Lrp1b UTSW 2 41376018 critical splice acceptor site probably null
R7437:Lrp1b UTSW 2 40822645 missense
R7437:Lrp1b UTSW 2 40822646 missense
R7446:Lrp1b UTSW 2 41671057 missense
R7460:Lrp1b UTSW 2 40598466 missense
R7462:Lrp1b UTSW 2 41113029 missense
R7475:Lrp1b UTSW 2 41344576 missense
R7479:Lrp1b UTSW 2 40801505 missense
R7523:Lrp1b UTSW 2 41511461 missense
R7525:Lrp1b UTSW 2 40657416 missense
R7549:Lrp1b UTSW 2 40875122 missense
R7552:Lrp1b UTSW 2 40677570 missense
R7558:Lrp1b UTSW 2 41341936 missense
R7587:Lrp1b UTSW 2 40730717 missense
R7599:Lrp1b UTSW 2 40661549 missense
R7635:Lrp1b UTSW 2 41123597 critical splice donor site probably null
R7663:Lrp1b UTSW 2 42653035 unclassified probably benign
R7674:Lrp1b UTSW 2 42652909 start gained probably benign
R7681:Lrp1b UTSW 2 40874999 nonsense probably null
R7703:Lrp1b UTSW 2 41110786 missense
R7742:Lrp1b UTSW 2 40822629 missense
R7767:Lrp1b UTSW 2 40801505 missense
R7829:Lrp1b UTSW 2 40903448 nonsense probably null
R7861:Lrp1b UTSW 2 40697558 missense
R7868:Lrp1b UTSW 2 41449234 missense
R7883:Lrp1b UTSW 2 40665129 missense
R7956:Lrp1b UTSW 2 41282149 splice site probably null
R7963:Lrp1b UTSW 2 40927935 missense
R7964:Lrp1b UTSW 2 40598511 missense
R8035:Lrp1b UTSW 2 40860655 missense
R8046:Lrp1b UTSW 2 41269187 missense
R8128:Lrp1b UTSW 2 41269236 missense probably null
R8234:Lrp1b UTSW 2 41312656 missense
R8237:Lrp1b UTSW 2 40851774 missense
R8244:Lrp1b UTSW 2 41506782 missense
R8370:Lrp1b UTSW 2 40998105 missense
R8395:Lrp1b UTSW 2 40657399 missense
R8398:Lrp1b UTSW 2 40701807 missense
R8421:Lrp1b UTSW 2 40725423 missense
R8426:Lrp1b UTSW 2 41498306 missense
R8443:Lrp1b UTSW 2 41375855 nonsense probably null
R8444:Lrp1b UTSW 2 40870260 missense
R8486:Lrp1b UTSW 2 41728690 missense probably damaging 1.00
R8500:Lrp1b UTSW 2 41506779 missense probably benign 0.12
R8507:Lrp1b UTSW 2 41408375 missense
R8552:Lrp1b UTSW 2 41408981 missense probably benign 0.00
R8554:Lrp1b UTSW 2 41344483 missense probably benign 0.28
R8669:Lrp1b UTSW 2 41282035 critical splice donor site probably null
R8699:Lrp1b UTSW 2 41282195 missense
R8796:Lrp1b UTSW 2 40903414 missense
R8815:Lrp1b UTSW 2 40665159 missense
R8842:Lrp1b UTSW 2 41268405 missense
R8858:Lrp1b UTSW 2 41670815 intron probably benign
R8864:Lrp1b UTSW 2 41112706 missense
R8918:Lrp1b UTSW 2 40725881 missense
R8920:Lrp1b UTSW 2 42323598 missense
R8963:Lrp1b UTSW 2 40998184 missense probably benign 0.28
R8971:Lrp1b UTSW 2 41435628 missense
R9007:Lrp1b UTSW 2 40697552 missense
R9042:Lrp1b UTSW 2 41502017 missense
R9053:Lrp1b UTSW 2 40858489 missense
R9063:Lrp1b UTSW 2 41341826 missense
R9072:Lrp1b UTSW 2 40725445 nonsense probably null
R9105:Lrp1b UTSW 2 41506791 missense
R9131:Lrp1b UTSW 2 40699578 nonsense probably null
R9226:Lrp1b UTSW 2 41511448 missense
R9245:Lrp1b UTSW 2 40598444 missense
R9275:Lrp1b UTSW 2 40597064 missense
R9278:Lrp1b UTSW 2 40597064 missense
R9303:Lrp1b UTSW 2 41728562 missense
R9305:Lrp1b UTSW 2 41728562 missense
R9306:Lrp1b UTSW 2 40628750 missense possibly damaging 0.66
R9320:Lrp1b UTSW 2 41445099 critical splice donor site probably null
R9330:Lrp1b UTSW 2 41122981 missense
R9352:Lrp1b UTSW 2 40858426 missense
R9386:Lrp1b UTSW 2 41123628 missense
R9397:Lrp1b UTSW 2 40750910 missense
RF018:Lrp1b UTSW 2 41110907 missense
RF020:Lrp1b UTSW 2 41770846 missense
V1662:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
X0028:Lrp1b UTSW 2 41471145 missense probably damaging 1.00
X0064:Lrp1b UTSW 2 41502043 missense probably damaging 1.00
Z1176:Lrp1b UTSW 2 40677506 missense
Z1176:Lrp1b UTSW 2 40697582 missense
Z1176:Lrp1b UTSW 2 40922383 missense
Z1176:Lrp1b UTSW 2 41728710 missense
Z1177:Lrp1b UTSW 2 40637749 missense
Z1177:Lrp1b UTSW 2 41188848 missense
Z1187:Lrp1b UTSW 2 40750934 missense
Z1188:Lrp1b UTSW 2 40750934 missense
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggagggagggggagaaag -3'
Posted On 2014-04-24