Incidental Mutation 'R1619:Rapsn'
Institutional Source Beutler Lab
Gene Symbol Rapsn
Ensembl Gene ENSMUSG00000002104
Gene Namereceptor-associated protein of the synapse
SynonymsNraps, rapsyn, 43kDa acetylcholine receptor-associated protein, Raps
MMRRC Submission 039656-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1619 (G1)
Quality Score212
Status Not validated
Chromosomal Location91035620-91045729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91043159 bp
Amino Acid Change Aspartic acid to Glycine at position 270 (D270G)
Ref Sequence ENSEMBL: ENSMUSP00000054150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050323] [ENSMUST00000111445] [ENSMUST00000111446]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050323
AA Change: D270G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054150
Gene: ENSMUSG00000002104
AA Change: D270G

TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 2e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
TPR 163 196 8.29e0 SMART
TPR 206 239 1.24e0 SMART
Blast:TPR 246 279 1e-14 BLAST
TPR 286 319 2.07e1 SMART
RING 363 402 2.67e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111445
SMART Domains Protein: ENSMUSP00000107072
Gene: ENSMUSG00000002104

TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 1e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
TPR 163 196 8.29e0 SMART
TPR 206 239 1.24e0 SMART
RING 304 343 2.67e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111446
AA Change: D217G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107073
Gene: ENSMUSG00000002104
AA Change: D217G

TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 1e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
Blast:TPR 193 226 9e-15 BLAST
TPR 233 266 2.07e1 SMART
RING 310 349 2.67e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146633
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are receptor associated proteins of the synapse. The encoded protein contains a conserved cAMP-dependent protein kinase phosphorylation site, and plays a critical role in clustering and anchoring nicotinic acetylcholine receptors at synaptic sites by linking the receptors to the underlying postsynaptic cytoskeleton, possibly by direct association with actin or spectrin. Mutations in this gene may play a role in postsynaptic congenital myasthenic syndromes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit absence of acetylcholine receptor clusters at end plate band of neuromuscular synapses, muscle weakness, and respiratory distress leading to lethality within hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,055 H1537L probably damaging Het
Actg2 T A 6: 83,523,187 N116I probably damaging Het
Actn1 G A 12: 80,173,022 H692Y probably damaging Het
Adamts6 C T 13: 104,312,777 P36S probably benign Het
Agr3 G A 12: 35,947,859 probably null Het
Ank3 T C 10: 69,879,975 V500A probably damaging Het
BC051019 T A 7: 109,718,062 D141V probably damaging Het
Bco1 T C 8: 117,108,715 F135S probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc42 A G 11: 68,594,289 K210E probably damaging Het
Cckar A T 5: 53,700,067 W263R probably damaging Het
Cela2a A G 4: 141,825,941 probably null Het
Cep97 A T 16: 55,927,796 N90K probably damaging Het
Ces2g A T 8: 104,967,352 Q440L probably damaging Het
Chchd6 G T 6: 89,419,754 T225K possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chrna5 A G 9: 55,004,365 T46A probably benign Het
Col16a1 G A 4: 130,098,940 G1531S probably damaging Het
Col19a1 A T 1: 24,534,091 V200E unknown Het
Csf2rb A G 15: 78,335,211 D2G probably damaging Het
Csmd3 G A 15: 47,949,950 S1062L probably damaging Het
Cul5 G T 9: 53,658,593 Q113K probably benign Het
Dmwd TAGCCTGGGAA TAGCCTGGGAAGCCTGGGAA 7: 19,081,034 probably benign Het
Dse T C 10: 34,153,234 D620G probably damaging Het
Dsg1c A G 18: 20,264,842 N33S probably benign Het
Epc2 G A 2: 49,549,978 V803I probably damaging Het
Erap1 T A 13: 74,671,381 H171Q probably damaging Het
Esrrb T C 12: 86,514,500 V336A possibly damaging Het
Fech A T 18: 64,462,118 W300R probably damaging Het
Fgd4 T C 16: 16,424,056 I635V possibly damaging Het
Galc A T 12: 98,234,304 N282K probably benign Het
Gpat2 A G 2: 127,428,717 Y95C probably benign Het
Grm2 T A 9: 106,647,471 I682F probably damaging Het
Hdac10 G T 15: 89,126,675 A241D probably damaging Het
Helz T A 11: 107,636,279 C182* probably null Het
Ift140 A G 17: 25,088,865 Y978C probably damaging Het
Intu T A 3: 40,697,631 C839* probably null Het
Jmjd1c T C 10: 67,219,875 V358A probably benign Het
Kif26b A G 1: 178,916,478 S1380G probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Lrrc2 T A 9: 110,960,973 S99R probably benign Het
Mrpl48 G A 7: 100,546,275 probably benign Het
Mup9 A G 4: 60,421,879 probably benign Het
Nap1l1 G A 10: 111,493,379 V285I possibly damaging Het
Nepro A G 16: 44,727,028 D36G probably benign Het
Nkain4 A G 2: 180,936,001 F187L probably damaging Het
Nobox A T 6: 43,307,467 C82S possibly damaging Het
Ntn4 C A 10: 93,644,734 Q70K probably damaging Het
Olfr1281 A G 2: 111,328,961 I181V probably benign Het
Olfr1484 T A 19: 13,585,614 F103L probably benign Het
Olfr385 A T 11: 73,589,292 W149R probably damaging Het
Olfr644 T C 7: 104,068,531 R167G probably damaging Het
Olfr71 A G 4: 43,706,292 I92T probably damaging Het
Olfr823 A G 10: 130,112,679 I37T possibly damaging Het
Pappa A G 4: 65,176,229 E497G probably damaging Het
Pard3 C A 8: 127,380,502 T569K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh10 A G 3: 45,380,312 N354D possibly damaging Het
Pdgfc T C 3: 81,174,887 V129A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Phf20l1 A T 15: 66,615,259 H407L possibly damaging Het
Phip A T 9: 82,871,449 D1747E probably benign Het
Pkd1l1 A G 11: 8,950,413 S43P probably damaging Het
Plekhg2 T C 7: 28,368,421 E202G probably damaging Het
Rims2 A C 15: 39,506,986 S939R probably damaging Het
Ripor3 T C 2: 167,980,845 D932G probably damaging Het
Rtp2 A T 16: 23,930,671 W30R probably damaging Het
Scgb2b27 A T 7: 34,012,132 D97E probably benign Het
Slc25a46 T C 18: 31,583,489 N320S probably benign Het
Slc9b1 A G 3: 135,355,004 probably null Het
Socs4 T A 14: 47,290,283 M225K possibly damaging Het
Spata31d1a A T 13: 59,702,433 L627* probably null Het
Srcin1 A G 11: 97,525,481 L975P probably damaging Het
Stard3 T A 11: 98,376,609 probably null Het
Susd2 G T 10: 75,638,044 S572R possibly damaging Het
Tll1 C A 8: 64,056,273 A568S probably benign Het
Tmem132a C G 19: 10,861,698 G460A probably damaging Het
Trim62 A G 4: 128,909,488 K444E probably damaging Het
Trpm3 A G 19: 22,711,907 T67A probably damaging Het
Ttc6 T C 12: 57,737,668 M1841T possibly damaging Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Vmn2r38 C A 7: 9,075,533 V617L probably damaging Het
Xkr6 G A 14: 63,819,317 V226M probably benign Het
Zfp940 G A 7: 29,845,537 A315V possibly damaging Het
Zfr C A 15: 12,150,387 T480K possibly damaging Het
Other mutations in Rapsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rapsn APN 2 91035860 missense probably damaging 1.00
IGL01386:Rapsn APN 2 91036799 missense probably damaging 1.00
IGL01517:Rapsn APN 2 91036618 missense probably damaging 1.00
IGL01707:Rapsn APN 2 91043240 missense probably benign 0.03
IGL02322:Rapsn APN 2 91041906 missense possibly damaging 0.80
IGL02800:Rapsn APN 2 91043239 missense probably benign
rasputin UTSW 2 91035924 missense probably damaging 1.00
R0744:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R0833:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R0836:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R1224:Rapsn UTSW 2 91043198 missense probably damaging 1.00
R1294:Rapsn UTSW 2 91036775 nonsense probably null
R2891:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R2892:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R2893:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R4135:Rapsn UTSW 2 91036817 missense probably damaging 0.99
R4515:Rapsn UTSW 2 91043212 missense possibly damaging 0.91
R5689:Rapsn UTSW 2 91035924 missense probably damaging 1.00
R5860:Rapsn UTSW 2 91045514 missense probably damaging 1.00
R5953:Rapsn UTSW 2 91041963 missense probably benign 0.04
R6495:Rapsn UTSW 2 91036628 missense probably damaging 1.00
R7644:Rapsn UTSW 2 91041954 missense possibly damaging 0.80
X0064:Rapsn UTSW 2 91043003 missense probably benign 0.14
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-04-24