Incidental Mutation 'R1619:Ripor3'
Institutional Source Beutler Lab
Gene Symbol Ripor3
Ensembl Gene ENSMUSG00000074577
Gene NameRIPOR family member 3
Synonyms2310033K02Rik, Fam65c
MMRRC Submission 039656-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1619 (G1)
Quality Score225
Status Not validated
Chromosomal Location167980164-168010618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167980845 bp
Amino Acid Change Aspartic acid to Glycine at position 932 (D932G)
Ref Sequence ENSEMBL: ENSMUSP00000096672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029053] [ENSMUST00000099073]
Predicted Effect probably benign
Transcript: ENSMUST00000029053
SMART Domains Protein: ENSMUSP00000029053
Gene: ENSMUSG00000027540

PTPc 15 279 1.35e-123 SMART
low complexity region 301 320 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099073
AA Change: D932G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096672
Gene: ENSMUSG00000074577
AA Change: D932G

Pfam:PL48 19 363 3.5e-169 PFAM
low complexity region 414 423 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
SCOP:d1gw5a_ 794 909 6e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131572
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,055 H1537L probably damaging Het
Actg2 T A 6: 83,523,187 N116I probably damaging Het
Actn1 G A 12: 80,173,022 H692Y probably damaging Het
Adamts6 C T 13: 104,312,777 P36S probably benign Het
Agr3 G A 12: 35,947,859 probably null Het
Ank3 T C 10: 69,879,975 V500A probably damaging Het
BC051019 T A 7: 109,718,062 D141V probably damaging Het
Bco1 T C 8: 117,108,715 F135S probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc42 A G 11: 68,594,289 K210E probably damaging Het
Cckar A T 5: 53,700,067 W263R probably damaging Het
Cela2a A G 4: 141,825,941 probably null Het
Cep97 A T 16: 55,927,796 N90K probably damaging Het
Ces2g A T 8: 104,967,352 Q440L probably damaging Het
Chchd6 G T 6: 89,419,754 T225K possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chrna5 A G 9: 55,004,365 T46A probably benign Het
Col16a1 G A 4: 130,098,940 G1531S probably damaging Het
Col19a1 A T 1: 24,534,091 V200E unknown Het
Csf2rb A G 15: 78,335,211 D2G probably damaging Het
Csmd3 G A 15: 47,949,950 S1062L probably damaging Het
Cul5 G T 9: 53,658,593 Q113K probably benign Het
Dmwd TAGCCTGGGAA TAGCCTGGGAAGCCTGGGAA 7: 19,081,034 probably benign Het
Dse T C 10: 34,153,234 D620G probably damaging Het
Dsg1c A G 18: 20,264,842 N33S probably benign Het
Epc2 G A 2: 49,549,978 V803I probably damaging Het
Erap1 T A 13: 74,671,381 H171Q probably damaging Het
Esrrb T C 12: 86,514,500 V336A possibly damaging Het
Fech A T 18: 64,462,118 W300R probably damaging Het
Fgd4 T C 16: 16,424,056 I635V possibly damaging Het
Galc A T 12: 98,234,304 N282K probably benign Het
Gpat2 A G 2: 127,428,717 Y95C probably benign Het
Grm2 T A 9: 106,647,471 I682F probably damaging Het
Hdac10 G T 15: 89,126,675 A241D probably damaging Het
Helz T A 11: 107,636,279 C182* probably null Het
Ift140 A G 17: 25,088,865 Y978C probably damaging Het
Intu T A 3: 40,697,631 C839* probably null Het
Jmjd1c T C 10: 67,219,875 V358A probably benign Het
Kif26b A G 1: 178,916,478 S1380G probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Lrrc2 T A 9: 110,960,973 S99R probably benign Het
Mrpl48 G A 7: 100,546,275 probably benign Het
Mup9 A G 4: 60,421,879 probably benign Het
Nap1l1 G A 10: 111,493,379 V285I possibly damaging Het
Nepro A G 16: 44,727,028 D36G probably benign Het
Nkain4 A G 2: 180,936,001 F187L probably damaging Het
Nobox A T 6: 43,307,467 C82S possibly damaging Het
Ntn4 C A 10: 93,644,734 Q70K probably damaging Het
Olfr1281 A G 2: 111,328,961 I181V probably benign Het
Olfr1484 T A 19: 13,585,614 F103L probably benign Het
Olfr385 A T 11: 73,589,292 W149R probably damaging Het
Olfr644 T C 7: 104,068,531 R167G probably damaging Het
Olfr71 A G 4: 43,706,292 I92T probably damaging Het
Olfr823 A G 10: 130,112,679 I37T possibly damaging Het
Pappa A G 4: 65,176,229 E497G probably damaging Het
Pard3 C A 8: 127,380,502 T569K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh10 A G 3: 45,380,312 N354D possibly damaging Het
Pdgfc T C 3: 81,174,887 V129A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Phf20l1 A T 15: 66,615,259 H407L possibly damaging Het
Phip A T 9: 82,871,449 D1747E probably benign Het
Pkd1l1 A G 11: 8,950,413 S43P probably damaging Het
Plekhg2 T C 7: 28,368,421 E202G probably damaging Het
Rapsn A G 2: 91,043,159 D270G possibly damaging Het
Rims2 A C 15: 39,506,986 S939R probably damaging Het
Rtp2 A T 16: 23,930,671 W30R probably damaging Het
Scgb2b27 A T 7: 34,012,132 D97E probably benign Het
Slc25a46 T C 18: 31,583,489 N320S probably benign Het
Slc9b1 A G 3: 135,355,004 probably null Het
Socs4 T A 14: 47,290,283 M225K possibly damaging Het
Spata31d1a A T 13: 59,702,433 L627* probably null Het
Srcin1 A G 11: 97,525,481 L975P probably damaging Het
Stard3 T A 11: 98,376,609 probably null Het
Susd2 G T 10: 75,638,044 S572R possibly damaging Het
Tll1 C A 8: 64,056,273 A568S probably benign Het
Tmem132a C G 19: 10,861,698 G460A probably damaging Het
Trim62 A G 4: 128,909,488 K444E probably damaging Het
Trpm3 A G 19: 22,711,907 T67A probably damaging Het
Ttc6 T C 12: 57,737,668 M1841T possibly damaging Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Vmn2r38 C A 7: 9,075,533 V617L probably damaging Het
Xkr6 G A 14: 63,819,317 V226M probably benign Het
Zfp940 G A 7: 29,845,537 A315V possibly damaging Het
Zfr C A 15: 12,150,387 T480K possibly damaging Het
Other mutations in Ripor3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Ripor3 APN 2 167993575 missense probably benign 0.05
IGL01621:Ripor3 APN 2 167997252 missense probably damaging 0.97
IGL01819:Ripor3 APN 2 167980843 missense probably damaging 0.99
IGL01891:Ripor3 APN 2 167983151 missense possibly damaging 0.95
IGL02110:Ripor3 APN 2 167994706 missense possibly damaging 0.95
IGL02270:Ripor3 APN 2 167993496 missense probably damaging 0.97
IGL02403:Ripor3 APN 2 167989330 missense probably damaging 1.00
IGL02445:Ripor3 APN 2 167992762 splice site probably benign
IGL02447:Ripor3 APN 2 167992830 missense probably damaging 0.99
IGL02711:Ripor3 APN 2 168006280 utr 5 prime probably benign
IGL03187:Ripor3 APN 2 167985668 missense possibly damaging 0.64
IGL03304:Ripor3 APN 2 167980928 splice site probably benign
R0062:Ripor3 UTSW 2 167984438 splice site probably benign
R0062:Ripor3 UTSW 2 167984438 splice site probably benign
R0233:Ripor3 UTSW 2 167992598 missense probably damaging 1.00
R0233:Ripor3 UTSW 2 167992598 missense probably damaging 1.00
R0387:Ripor3 UTSW 2 167983772 nonsense probably null
R1457:Ripor3 UTSW 2 167992653 missense probably damaging 1.00
R1481:Ripor3 UTSW 2 168000377 missense possibly damaging 0.95
R2358:Ripor3 UTSW 2 167983865 splice site probably benign
R2431:Ripor3 UTSW 2 167989795 missense probably benign 0.06
R2943:Ripor3 UTSW 2 167983761 missense possibly damaging 0.46
R3000:Ripor3 UTSW 2 167991180 missense probably damaging 1.00
R3730:Ripor3 UTSW 2 167992819 missense probably damaging 1.00
R3731:Ripor3 UTSW 2 167992819 missense probably damaging 1.00
R4084:Ripor3 UTSW 2 167984466 missense possibly damaging 0.55
R4796:Ripor3 UTSW 2 167981340 missense probably damaging 0.97
R4854:Ripor3 UTSW 2 167992813 missense probably benign 0.05
R4934:Ripor3 UTSW 2 167982816 missense probably benign
R4968:Ripor3 UTSW 2 167985117 missense probably benign 0.41
R5662:Ripor3 UTSW 2 167993556 missense probably benign 0.01
R5739:Ripor3 UTSW 2 167981283 missense probably damaging 1.00
R5888:Ripor3 UTSW 2 167997287 missense probably damaging 1.00
R6844:Ripor3 UTSW 2 167993333 splice site probably null
R6969:Ripor3 UTSW 2 167985737 missense probably benign 0.01
R6994:Ripor3 UTSW 2 167997266 missense probably damaging 0.99
R7609:Ripor3 UTSW 2 167984570 missense possibly damaging 0.86
R7818:Ripor3 UTSW 2 167989426 missense probably benign 0.09
R8329:Ripor3 UTSW 2 167983199 missense possibly damaging 0.89
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-04-24