Mutagenetix > Incidental Mutation

Incidental Mutation 'R1619:Intu'

174497

Institutional Source

Beutler Lab

Gene Symbol

Intu

Ensembl Gene

ENSMUSG00000060798

Gene Name

inturned planar cell polarity protein

Synonyms

Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik

MMRRC Submission

039656-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1619 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40531286-40704774 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 40697631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 839 (C839*)

Ref Sequence

ENSEMBL: ENSMUSP00000088725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091186]

AlphaFold

Q059U7

Predicted Effect

probably null
Transcript: ENSMUST00000091186
AA Change: C839*

SMART Domains

Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: C839*

Domain	Start	End	E-Value	Type
low complexity region	21	48	N/A	INTRINSIC
low complexity region	64	81	N/A	INTRINSIC
PDZ	187	269	2.09e-3	SMART
low complexity region	459	468	N/A	INTRINSIC
low complexity region	774	784	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 91.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	A	T	10: 80,009,055	H1537L	probably damaging	Het
Actg2	T	A	6: 83,523,187	N116I	probably damaging	Het
Actn1	G	A	12: 80,173,022	H692Y	probably damaging	Het
Adamts6	C	T	13: 104,312,777	P36S	probably benign	Het
Agr3	G	A	12: 35,947,859		probably null	Het
Ank3	T	C	10: 69,879,975	V500A	probably damaging	Het
BC051019	T	A	7: 109,718,062	D141V	probably damaging	Het
Bco1	T	C	8: 117,108,715	F135S	probably damaging	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Ccdc42	A	G	11: 68,594,289	K210E	probably damaging	Het
Cckar	A	T	5: 53,700,067	W263R	probably damaging	Het
Cela2a	A	G	4: 141,825,941		probably null	Het
Cep97	A	T	16: 55,927,796	N90K	probably damaging	Het
Ces2g	A	T	8: 104,967,352	Q440L	probably damaging	Het
Chchd6	G	T	6: 89,419,754	T225K	possibly damaging	Het
Chd1l	C	T	3: 97,582,731	E503K	probably benign	Het
Chrna5	A	G	9: 55,004,365	T46A	probably benign	Het
Col16a1	G	A	4: 130,098,940	G1531S	probably damaging	Het
Col19a1	A	T	1: 24,534,091	V200E	unknown	Het
Csf2rb	A	G	15: 78,335,211	D2G	probably damaging	Het
Csmd3	G	A	15: 47,949,950	S1062L	probably damaging	Het
Cul5	G	T	9: 53,658,593	Q113K	probably benign	Het
Dmwd	TAGCCTGGGAA	TAGCCTGGGAAGCCTGGGAA	7: 19,081,034		probably benign	Het
Dse	T	C	10: 34,153,234	D620G	probably damaging	Het
Dsg1c	A	G	18: 20,264,842	N33S	probably benign	Het
Epc2	G	A	2: 49,549,978	V803I	probably damaging	Het
Erap1	T	A	13: 74,671,381	H171Q	probably damaging	Het
Esrrb	T	C	12: 86,514,500	V336A	possibly damaging	Het
Fech	A	T	18: 64,462,118	W300R	probably damaging	Het
Fgd4	T	C	16: 16,424,056	I635V	possibly damaging	Het
Galc	A	T	12: 98,234,304	N282K	probably benign	Het
Gpat2	A	G	2: 127,428,717	Y95C	probably benign	Het
Grm2	T	A	9: 106,647,471	I682F	probably damaging	Het
Hdac10	G	T	15: 89,126,675	A241D	probably damaging	Het
Helz	T	A	11: 107,636,279	C182*	probably null	Het
Ift140	A	G	17: 25,088,865	Y978C	probably damaging	Het
Jmjd1c	T	C	10: 67,219,875	V358A	probably benign	Het
Kif26b	A	G	1: 178,916,478	S1380G	probably benign	Het
Lrp1b	A	G	2: 40,697,589	S116P	unknown	Het
Lrrc2	T	A	9: 110,960,973	S99R	probably benign	Het
Mrpl48	G	A	7: 100,546,275		probably benign	Het
Mup9	A	G	4: 60,421,879		probably benign	Het
Nap1l1	G	A	10: 111,493,379	V285I	possibly damaging	Het
Nepro	A	G	16: 44,727,028	D36G	probably benign	Het
Nkain4	A	G	2: 180,936,001	F187L	probably damaging	Het
Nobox	A	T	6: 43,307,467	C82S	possibly damaging	Het
Ntn4	C	A	10: 93,644,734	Q70K	probably damaging	Het
Olfr1281	A	G	2: 111,328,961	I181V	probably benign	Het
Olfr1484	T	A	19: 13,585,614	F103L	probably benign	Het
Olfr385	A	T	11: 73,589,292	W149R	probably damaging	Het
Olfr644	T	C	7: 104,068,531	R167G	probably damaging	Het
Olfr71	A	G	4: 43,706,292	I92T	probably damaging	Het
Olfr823	A	G	10: 130,112,679	I37T	possibly damaging	Het
Pappa	A	G	4: 65,176,229	E497G	probably damaging	Het
Pard3	C	A	8: 127,380,502	T569K	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pcdh10	A	G	3: 45,380,312	N354D	possibly damaging	Het
Pdgfc	T	C	3: 81,174,887	V129A	probably benign	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Phf20l1	A	T	15: 66,615,259	H407L	possibly damaging	Het
Phip	A	T	9: 82,871,449	D1747E	probably benign	Het
Pkd1l1	A	G	11: 8,950,413	S43P	probably damaging	Het
Plekhg2	T	C	7: 28,368,421	E202G	probably damaging	Het
Rapsn	A	G	2: 91,043,159	D270G	possibly damaging	Het
Rims2	A	C	15: 39,506,986	S939R	probably damaging	Het
Ripor3	T	C	2: 167,980,845	D932G	probably damaging	Het
Rtp2	A	T	16: 23,930,671	W30R	probably damaging	Het
Scgb2b27	A	T	7: 34,012,132	D97E	probably benign	Het
Slc25a46	T	C	18: 31,583,489	N320S	probably benign	Het
Slc9b1	A	G	3: 135,355,004		probably null	Het
Socs4	T	A	14: 47,290,283	M225K	possibly damaging	Het
Spata31d1a	A	T	13: 59,702,433	L627*	probably null	Het
Srcin1	A	G	11: 97,525,481	L975P	probably damaging	Het
Stard3	T	A	11: 98,376,609		probably null	Het
Susd2	G	T	10: 75,638,044	S572R	possibly damaging	Het
Tll1	C	A	8: 64,056,273	A568S	probably benign	Het
Tmem132a	C	G	19: 10,861,698	G460A	probably damaging	Het
Trim62	A	G	4: 128,909,488	K444E	probably damaging	Het
Trpm3	A	G	19: 22,711,907	T67A	probably damaging	Het
Ttc6	T	C	12: 57,737,668	M1841T	possibly damaging	Het
Ulk2	A	T	11: 61,781,746	V922D	probably damaging	Het
Vmn2r38	C	A	7: 9,075,533	V617L	probably damaging	Het
Xkr6	G	A	14: 63,819,317	V226M	probably benign	Het
Zfp940	G	A	7: 29,845,537	A315V	possibly damaging	Het
Zfr	C	A	15: 12,150,387	T480K	possibly damaging	Het

Other mutations in Intu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01292:Intu	APN	3	40664266	missense	probably benign	0.12
IGL01386:Intu	APN	3	40692587	missense	probably damaging	1.00
IGL02645:Intu	APN	3	40701272	missense	probably benign	0.01
IGL02869:Intu	APN	3	40687786	missense	probably damaging	1.00
IGL03263:Intu	APN	3	40672597	nonsense	probably null
H8562:Intu	UTSW	3	40692673	missense	probably damaging	1.00
PIT4495001:Intu	UTSW	3	40697603	missense	probably benign	0.07
R0010:Intu	UTSW	3	40654272	intron	probably benign
R0173:Intu	UTSW	3	40675346	critical splice donor site	probably null
R0426:Intu	UTSW	3	40675305	missense	probably damaging	0.97
R1566:Intu	UTSW	3	40692578	missense	probably damaging	0.99
R1658:Intu	UTSW	3	40692781	missense	probably benign	0.20
R1701:Intu	UTSW	3	40664264	missense	probably damaging	1.00
R1707:Intu	UTSW	3	40540924	missense	probably benign	0.03
R1707:Intu	UTSW	3	40683501	missense	possibly damaging	0.69
R1867:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R1868:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R2090:Intu	UTSW	3	40683536	missense	probably benign	0.00
R2310:Intu	UTSW	3	40653813	missense	probably benign
R2989:Intu	UTSW	3	40692710	missense	probably benign	0.11
R4168:Intu	UTSW	3	40672623	missense	probably benign	0.00
R4530:Intu	UTSW	3	40683364	missense	possibly damaging	0.95
R5093:Intu	UTSW	3	40692917	missense	probably benign	0.00
R5541:Intu	UTSW	3	40692587	splice site	probably null
R5587:Intu	UTSW	3	40675308	missense	probably damaging	0.99
R5745:Intu	UTSW	3	40692972	splice site	probably null
R5809:Intu	UTSW	3	40679590	missense	probably damaging	0.99
R5939:Intu	UTSW	3	40692584	missense	probably damaging	1.00
R5953:Intu	UTSW	3	40679550	missense	probably damaging	1.00
R6000:Intu	UTSW	3	40654148	nonsense	probably null
R6063:Intu	UTSW	3	40654094	missense	probably damaging	0.97
R6245:Intu	UTSW	3	40675326	missense	probably damaging	0.98
R6310:Intu	UTSW	3	40701291	nonsense	probably null
R6353:Intu	UTSW	3	40653708	missense	probably damaging	1.00
R6451:Intu	UTSW	3	40701293	missense	possibly damaging	0.94
R6660:Intu	UTSW	3	40531951	missense	probably benign	0.00
R6848:Intu	UTSW	3	40694255	missense	probably benign	0.00
R7440:Intu	UTSW	3	40697551	missense	probably benign	0.04
R7625:Intu	UTSW	3	40697599	missense	probably benign
R7633:Intu	UTSW	3	40654253	missense	probably damaging	1.00
R7798:Intu	UTSW	3	40691929	missense	probably damaging	1.00
R7877:Intu	UTSW	3	40699792	missense	probably benign	0.07
R7978:Intu	UTSW	3	40697639	missense	probably damaging	1.00
R8319:Intu	UTSW	3	40653772	missense	probably damaging	1.00
R8332:Intu	UTSW	3	40675289	missense	probably benign	0.35
R8860:Intu	UTSW	3	40672732	missense	probably benign	0.07
R8926:Intu	UTSW	3	40653709	missense	possibly damaging	0.69
R8946:Intu	UTSW	3	40683359	missense	possibly damaging	0.93
R9164:Intu	UTSW	3	40690703	missense	probably damaging	1.00
R9191:Intu	UTSW	3	40692511	missense	probably damaging	0.99
R9547:Intu	UTSW	3	40654106	missense	probably benign
Z1177:Intu	UTSW	3	40697516	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GATTGACCTCCGGTCCTGAGAATACAC -3'
(R):5'- TTCAGCCCAGATTGAAACAGTATCCAC -3'

Sequencing Primer
(F):5'- GAGAATACACTCTTCCACTATGTTGC -3'
(R):5'- AGTATCCACCAACTTACACATGG -3'

Posted On

2014-04-24