Incidental Mutation 'R1619:Tll1'
Institutional Source Beutler Lab
Gene Symbol Tll1
Ensembl Gene ENSMUSG00000053626
Gene Nametolloid-like
MMRRC Submission 039656-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1619 (G1)
Quality Score225
Status Not validated
Chromosomal Location64014931-64206271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64056273 bp
Amino Acid Change Alanine to Serine at position 568 (A568S)
Ref Sequence ENSEMBL: ENSMUSP00000070560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066166]
Predicted Effect probably benign
Transcript: ENSMUST00000066166
AA Change: A568S

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: A568S

ZnMc 153 295 4.12e-56 SMART
CUB 349 461 4.12e-44 SMART
CUB 462 574 3.81e-48 SMART
EGF_CA 574 615 2.28e-9 SMART
CUB 618 730 9.11e-46 SMART
EGF_CA 730 770 4.25e-9 SMART
CUB 774 886 2.01e-47 SMART
CUB 887 1003 7.19e-35 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,055 H1537L probably damaging Het
Actg2 T A 6: 83,523,187 N116I probably damaging Het
Actn1 G A 12: 80,173,022 H692Y probably damaging Het
Adamts6 C T 13: 104,312,777 P36S probably benign Het
Agr3 G A 12: 35,947,859 probably null Het
Ank3 T C 10: 69,879,975 V500A probably damaging Het
BC051019 T A 7: 109,718,062 D141V probably damaging Het
Bco1 T C 8: 117,108,715 F135S probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc42 A G 11: 68,594,289 K210E probably damaging Het
Cckar A T 5: 53,700,067 W263R probably damaging Het
Cela2a A G 4: 141,825,941 probably null Het
Cep97 A T 16: 55,927,796 N90K probably damaging Het
Ces2g A T 8: 104,967,352 Q440L probably damaging Het
Chchd6 G T 6: 89,419,754 T225K possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chrna5 A G 9: 55,004,365 T46A probably benign Het
Col16a1 G A 4: 130,098,940 G1531S probably damaging Het
Col19a1 A T 1: 24,534,091 V200E unknown Het
Csf2rb A G 15: 78,335,211 D2G probably damaging Het
Csmd3 G A 15: 47,949,950 S1062L probably damaging Het
Cul5 G T 9: 53,658,593 Q113K probably benign Het
Dmwd TAGCCTGGGAA TAGCCTGGGAAGCCTGGGAA 7: 19,081,034 probably benign Het
Dse T C 10: 34,153,234 D620G probably damaging Het
Dsg1c A G 18: 20,264,842 N33S probably benign Het
Epc2 G A 2: 49,549,978 V803I probably damaging Het
Erap1 T A 13: 74,671,381 H171Q probably damaging Het
Esrrb T C 12: 86,514,500 V336A possibly damaging Het
Fech A T 18: 64,462,118 W300R probably damaging Het
Fgd4 T C 16: 16,424,056 I635V possibly damaging Het
Galc A T 12: 98,234,304 N282K probably benign Het
Gpat2 A G 2: 127,428,717 Y95C probably benign Het
Grm2 T A 9: 106,647,471 I682F probably damaging Het
Hdac10 G T 15: 89,126,675 A241D probably damaging Het
Helz T A 11: 107,636,279 C182* probably null Het
Ift140 A G 17: 25,088,865 Y978C probably damaging Het
Intu T A 3: 40,697,631 C839* probably null Het
Jmjd1c T C 10: 67,219,875 V358A probably benign Het
Kif26b A G 1: 178,916,478 S1380G probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Lrrc2 T A 9: 110,960,973 S99R probably benign Het
Mrpl48 G A 7: 100,546,275 probably benign Het
Mup9 A G 4: 60,421,879 probably benign Het
Nap1l1 G A 10: 111,493,379 V285I possibly damaging Het
Nepro A G 16: 44,727,028 D36G probably benign Het
Nkain4 A G 2: 180,936,001 F187L probably damaging Het
Nobox A T 6: 43,307,467 C82S possibly damaging Het
Ntn4 C A 10: 93,644,734 Q70K probably damaging Het
Olfr1281 A G 2: 111,328,961 I181V probably benign Het
Olfr1484 T A 19: 13,585,614 F103L probably benign Het
Olfr385 A T 11: 73,589,292 W149R probably damaging Het
Olfr644 T C 7: 104,068,531 R167G probably damaging Het
Olfr71 A G 4: 43,706,292 I92T probably damaging Het
Olfr823 A G 10: 130,112,679 I37T possibly damaging Het
Pappa A G 4: 65,176,229 E497G probably damaging Het
Pard3 C A 8: 127,380,502 T569K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh10 A G 3: 45,380,312 N354D possibly damaging Het
Pdgfc T C 3: 81,174,887 V129A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Phf20l1 A T 15: 66,615,259 H407L possibly damaging Het
Phip A T 9: 82,871,449 D1747E probably benign Het
Pkd1l1 A G 11: 8,950,413 S43P probably damaging Het
Plekhg2 T C 7: 28,368,421 E202G probably damaging Het
Rapsn A G 2: 91,043,159 D270G possibly damaging Het
Rims2 A C 15: 39,506,986 S939R probably damaging Het
Ripor3 T C 2: 167,980,845 D932G probably damaging Het
Rtp2 A T 16: 23,930,671 W30R probably damaging Het
Scgb2b27 A T 7: 34,012,132 D97E probably benign Het
Slc25a46 T C 18: 31,583,489 N320S probably benign Het
Slc9b1 A G 3: 135,355,004 probably null Het
Socs4 T A 14: 47,290,283 M225K possibly damaging Het
Spata31d1a A T 13: 59,702,433 L627* probably null Het
Srcin1 A G 11: 97,525,481 L975P probably damaging Het
Stard3 T A 11: 98,376,609 probably null Het
Susd2 G T 10: 75,638,044 S572R possibly damaging Het
Tmem132a C G 19: 10,861,698 G460A probably damaging Het
Trim62 A G 4: 128,909,488 K444E probably damaging Het
Trpm3 A G 19: 22,711,907 T67A probably damaging Het
Ttc6 T C 12: 57,737,668 M1841T possibly damaging Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Vmn2r38 C A 7: 9,075,533 V617L probably damaging Het
Xkr6 G A 14: 63,819,317 V226M probably benign Het
Zfp940 G A 7: 29,845,537 A315V possibly damaging Het
Zfr C A 15: 12,150,387 T480K possibly damaging Het
Other mutations in Tll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tll1 APN 8 64016136 missense probably benign
IGL00583:Tll1 APN 8 64205292 missense probably benign
IGL00767:Tll1 APN 8 64071321 missense probably damaging 1.00
IGL01061:Tll1 APN 8 64038454 critical splice donor site probably null
IGL01077:Tll1 APN 8 64070232 missense probably benign 0.27
IGL01536:Tll1 APN 8 64074289 missense probably damaging 1.00
IGL02137:Tll1 APN 8 64016098 missense possibly damaging 0.73
IGL02168:Tll1 APN 8 64053967 missense possibly damaging 0.50
IGL02378:Tll1 APN 8 64017626 nonsense probably null
IGL02469:Tll1 APN 8 64070280 missense probably benign 0.41
IGL02504:Tll1 APN 8 64070237 missense possibly damaging 0.55
IGL02650:Tll1 APN 8 64046997 splice site probably benign
IGL02937:Tll1 APN 8 64205285 nonsense probably null
IGL03006:Tll1 APN 8 64074217 splice site probably benign
R0518:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0521:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0541:Tll1 UTSW 8 64038452 splice site probably null
R0612:Tll1 UTSW 8 64071310 missense possibly damaging 0.91
R0690:Tll1 UTSW 8 64074290 missense probably damaging 0.99
R0738:Tll1 UTSW 8 64101950 missense probably damaging 1.00
R1454:Tll1 UTSW 8 64038490 missense probably benign
R1625:Tll1 UTSW 8 64041442 missense probably damaging 1.00
R1654:Tll1 UTSW 8 64117903 critical splice donor site probably null
R1663:Tll1 UTSW 8 64017686 missense probably benign 0.08
R1681:Tll1 UTSW 8 64085551 missense possibly damaging 0.93
R1713:Tll1 UTSW 8 64101873 missense probably damaging 0.99
R1908:Tll1 UTSW 8 64025107 missense probably damaging 0.98
R2118:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2121:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2124:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2360:Tll1 UTSW 8 64051401 missense probably damaging 1.00
R2396:Tll1 UTSW 8 64070290 nonsense probably null
R3032:Tll1 UTSW 8 64098492 missense probably damaging 0.96
R3115:Tll1 UTSW 8 64053866 missense probably damaging 1.00
R3889:Tll1 UTSW 8 64205224 missense possibly damaging 0.77
R4126:Tll1 UTSW 8 64118014 missense possibly damaging 0.78
R4182:Tll1 UTSW 8 64041511 missense probably damaging 1.00
R4572:Tll1 UTSW 8 64056309 missense possibly damaging 0.81
R4677:Tll1 UTSW 8 64051377 missense probably benign 0.31
R4811:Tll1 UTSW 8 64085473 missense possibly damaging 0.72
R4904:Tll1 UTSW 8 64070199 missense probably benign 0.00
R4992:Tll1 UTSW 8 64093944 missense probably damaging 0.98
R5061:Tll1 UTSW 8 64053949 missense probably damaging 0.99
R5078:Tll1 UTSW 8 64093887 missense probably damaging 1.00
R5208:Tll1 UTSW 8 64051493 missense probably damaging 0.99
R5283:Tll1 UTSW 8 64101966 missense possibly damaging 0.68
R5399:Tll1 UTSW 8 64085488 missense probably damaging 1.00
R5699:Tll1 UTSW 8 64117940 missense probably damaging 0.98
R5986:Tll1 UTSW 8 64074263 missense probably damaging 0.99
R6019:Tll1 UTSW 8 64041491 missense possibly damaging 0.83
R6046:Tll1 UTSW 8 64053891 nonsense probably null
R6083:Tll1 UTSW 8 64038586 splice site probably null
R6125:Tll1 UTSW 8 64051487 missense probably damaging 1.00
R6222:Tll1 UTSW 8 64098534 missense probably benign 0.18
R6275:Tll1 UTSW 8 64051367 nonsense probably null
R6508:Tll1 UTSW 8 64098460 missense probably damaging 0.99
R6758:Tll1 UTSW 8 64041405 critical splice donor site probably null
R6782:Tll1 UTSW 8 64071281 missense probably benign 0.00
R6848:Tll1 UTSW 8 64098510 missense probably damaging 0.99
R7057:Tll1 UTSW 8 64101881 missense probably damaging 1.00
R7144:Tll1 UTSW 8 64124945 missense possibly damaging 0.90
R7244:Tll1 UTSW 8 64025188 missense probably benign 0.00
R7336:Tll1 UTSW 8 64025142 missense probably damaging 0.98
R7373:Tll1 UTSW 8 64051357 missense probably damaging 0.98
R7626:Tll1 UTSW 8 64098234 intron probably null
R7687:Tll1 UTSW 8 64121492 nonsense probably null
R7699:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7700:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7765:Tll1 UTSW 8 64051449 missense probably damaging 1.00
R7790:Tll1 UTSW 8 64025237 nonsense probably null
X0020:Tll1 UTSW 8 64017628 missense probably damaging 0.97
Z1176:Tll1 UTSW 8 64047163 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-04-24