Mutagenetix > Incidental Mutation

Incidental Mutation 'R1619:Rims2'

174565

Institutional Source

Beutler Lab

Gene Symbol

Rims2

Ensembl Gene

ENSMUSG00000037386

Gene Name

regulating synaptic membrane exocytosis 2

Synonyms

2810036I15Rik, Syt3-rs, RIM2

MMRRC Submission

039656-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.630) question?

Stock #

R1619 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39198261-39684372 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 39506986 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 939 (S939R)

Ref Sequence

ENSEMBL: ENSMUSP00000048719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]

AlphaFold

Q9EQZ7

Predicted Effect

probably damaging
Transcript: ENSMUST00000042917
AA Change: S939R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: S939R

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	30	154	9.5e-18	PFAM
low complexity region	315	335	N/A	INTRINSIC
low complexity region	492	498	N/A	INTRINSIC
low complexity region	511	521	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
PDZ	646	725	8.27e-16	SMART
low complexity region	740	748	N/A	INTRINSIC
C2	790	897	4.08e-21	SMART
low complexity region	905	919	N/A	INTRINSIC
low complexity region	1085	1101	N/A	INTRINSIC
low complexity region	1116	1130	N/A	INTRINSIC
low complexity region	1208	1238	N/A	INTRINSIC
C2	1432	1535	3.78e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000082054
AA Change: S979R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386
AA Change: S979R

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	76	194	2.2e-11	PFAM
low complexity region	355	375	N/A	INTRINSIC
low complexity region	532	538	N/A	INTRINSIC
low complexity region	551	561	N/A	INTRINSIC
low complexity region	567	580	N/A	INTRINSIC
PDZ	686	765	8.27e-16	SMART
low complexity region	780	788	N/A	INTRINSIC
C2	830	937	4.08e-21	SMART
low complexity region	945	959	N/A	INTRINSIC
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1166	1196	N/A	INTRINSIC
C2	1390	1493	3.78e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227243
AA Change: S939R

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

unknown
Transcript: ENSMUST00000227381
AA Change: S659R

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	A	T	10: 80,009,055	H1537L	probably damaging	Het
Actg2	T	A	6: 83,523,187	N116I	probably damaging	Het
Actn1	G	A	12: 80,173,022	H692Y	probably damaging	Het
Adamts6	C	T	13: 104,312,777	P36S	probably benign	Het
Agr3	G	A	12: 35,947,859		probably null	Het
Ank3	T	C	10: 69,879,975	V500A	probably damaging	Het
BC051019	T	A	7: 109,718,062	D141V	probably damaging	Het
Bco1	T	C	8: 117,108,715	F135S	probably damaging	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Ccdc42	A	G	11: 68,594,289	K210E	probably damaging	Het
Cckar	A	T	5: 53,700,067	W263R	probably damaging	Het
Cela2a	A	G	4: 141,825,941		probably null	Het
Cep97	A	T	16: 55,927,796	N90K	probably damaging	Het
Ces2g	A	T	8: 104,967,352	Q440L	probably damaging	Het
Chchd6	G	T	6: 89,419,754	T225K	possibly damaging	Het
Chd1l	C	T	3: 97,582,731	E503K	probably benign	Het
Chrna5	A	G	9: 55,004,365	T46A	probably benign	Het
Col16a1	G	A	4: 130,098,940	G1531S	probably damaging	Het
Col19a1	A	T	1: 24,534,091	V200E	unknown	Het
Csf2rb	A	G	15: 78,335,211	D2G	probably damaging	Het
Csmd3	G	A	15: 47,949,950	S1062L	probably damaging	Het
Cul5	G	T	9: 53,658,593	Q113K	probably benign	Het
Dmwd	TAGCCTGGGAA	TAGCCTGGGAAGCCTGGGAA	7: 19,081,034		probably benign	Het
Dse	T	C	10: 34,153,234	D620G	probably damaging	Het
Dsg1c	A	G	18: 20,264,842	N33S	probably benign	Het
Epc2	G	A	2: 49,549,978	V803I	probably damaging	Het
Erap1	T	A	13: 74,671,381	H171Q	probably damaging	Het
Esrrb	T	C	12: 86,514,500	V336A	possibly damaging	Het
Fech	A	T	18: 64,462,118	W300R	probably damaging	Het
Fgd4	T	C	16: 16,424,056	I635V	possibly damaging	Het
Galc	A	T	12: 98,234,304	N282K	probably benign	Het
Gpat2	A	G	2: 127,428,717	Y95C	probably benign	Het
Grm2	T	A	9: 106,647,471	I682F	probably damaging	Het
Hdac10	G	T	15: 89,126,675	A241D	probably damaging	Het
Helz	T	A	11: 107,636,279	C182*	probably null	Het
Ift140	A	G	17: 25,088,865	Y978C	probably damaging	Het
Intu	T	A	3: 40,697,631	C839*	probably null	Het
Jmjd1c	T	C	10: 67,219,875	V358A	probably benign	Het
Kif26b	A	G	1: 178,916,478	S1380G	probably benign	Het
Lrp1b	A	G	2: 40,697,589	S116P	unknown	Het
Lrrc2	T	A	9: 110,960,973	S99R	probably benign	Het
Mrpl48	G	A	7: 100,546,275		probably benign	Het
Mup9	A	G	4: 60,421,879		probably benign	Het
Nap1l1	G	A	10: 111,493,379	V285I	possibly damaging	Het
Nepro	A	G	16: 44,727,028	D36G	probably benign	Het
Nkain4	A	G	2: 180,936,001	F187L	probably damaging	Het
Nobox	A	T	6: 43,307,467	C82S	possibly damaging	Het
Ntn4	C	A	10: 93,644,734	Q70K	probably damaging	Het
Olfr1281	A	G	2: 111,328,961	I181V	probably benign	Het
Olfr1484	T	A	19: 13,585,614	F103L	probably benign	Het
Olfr385	A	T	11: 73,589,292	W149R	probably damaging	Het
Olfr644	T	C	7: 104,068,531	R167G	probably damaging	Het
Olfr71	A	G	4: 43,706,292	I92T	probably damaging	Het
Olfr823	A	G	10: 130,112,679	I37T	possibly damaging	Het
Pappa	A	G	4: 65,176,229	E497G	probably damaging	Het
Pard3	C	A	8: 127,380,502	T569K	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pcdh10	A	G	3: 45,380,312	N354D	possibly damaging	Het
Pdgfc	T	C	3: 81,174,887	V129A	probably benign	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Phf20l1	A	T	15: 66,615,259	H407L	possibly damaging	Het
Phip	A	T	9: 82,871,449	D1747E	probably benign	Het
Pkd1l1	A	G	11: 8,950,413	S43P	probably damaging	Het
Plekhg2	T	C	7: 28,368,421	E202G	probably damaging	Het
Rapsn	A	G	2: 91,043,159	D270G	possibly damaging	Het
Ripor3	T	C	2: 167,980,845	D932G	probably damaging	Het
Rtp2	A	T	16: 23,930,671	W30R	probably damaging	Het
Scgb2b27	A	T	7: 34,012,132	D97E	probably benign	Het
Slc25a46	T	C	18: 31,583,489	N320S	probably benign	Het
Slc9b1	A	G	3: 135,355,004		probably null	Het
Socs4	T	A	14: 47,290,283	M225K	possibly damaging	Het
Spata31d1a	A	T	13: 59,702,433	L627*	probably null	Het
Srcin1	A	G	11: 97,525,481	L975P	probably damaging	Het
Stard3	T	A	11: 98,376,609		probably null	Het
Susd2	G	T	10: 75,638,044	S572R	possibly damaging	Het
Tll1	C	A	8: 64,056,273	A568S	probably benign	Het
Tmem132a	C	G	19: 10,861,698	G460A	probably damaging	Het
Trim62	A	G	4: 128,909,488	K444E	probably damaging	Het
Trpm3	A	G	19: 22,711,907	T67A	probably damaging	Het
Ttc6	T	C	12: 57,737,668	M1841T	possibly damaging	Het
Ulk2	A	T	11: 61,781,746	V922D	probably damaging	Het
Vmn2r38	C	A	7: 9,075,533	V617L	probably damaging	Het
Xkr6	G	A	14: 63,819,317	V226M	probably benign	Het
Zfp940	G	A	7: 29,845,537	A315V	possibly damaging	Het
Zfr	C	A	15: 12,150,387	T480K	possibly damaging	Het

Other mutations in Rims2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Rims2	APN	15	39459615	missense	probably benign	0.11
IGL00502:Rims2	APN	15	39506984	missense	probably damaging	1.00
IGL00556:Rims2	APN	15	39456674	splice site	probably null
IGL00811:Rims2	APN	15	39292149	missense	probably damaging	1.00
IGL00827:Rims2	APN	15	39472359	missense	probably damaging	0.99
IGL01642:Rims2	APN	15	39457796	missense	probably damaging	1.00
IGL02951:Rims2	APN	15	39534938	missense	probably damaging	1.00
IGL03009:Rims2	APN	15	39566997	missense	possibly damaging	0.85
IGL03080:Rims2	APN	15	39535903	missense	probably damaging	1.00
IGL03102:Rims2	APN	15	39459593	missense	possibly damaging	0.95
IGL03252:Rims2	APN	15	39452352	missense	probably benign
IGL03365:Rims2	APN	15	39476541	missense	probably damaging	1.00
IGL03393:Rims2	APN	15	39462613	splice site	probably null
IGL03409:Rims2	APN	15	39456733	missense	probably damaging	1.00
rhyme	UTSW	15	39452328	missense	probably damaging	1.00
PIT4486001:Rims2	UTSW	15	39476520	missense	possibly damaging	0.67
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0078:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R0367:Rims2	UTSW	15	39462615	splice site	probably null
R0401:Rims2	UTSW	15	39509632	splice site	probably benign
R0531:Rims2	UTSW	15	39567030	missense	probably damaging	1.00
R0791:Rims2	UTSW	15	39679625	splice site	probably benign
R0838:Rims2	UTSW	15	39681025	missense	probably benign	0.02
R1201:Rims2	UTSW	15	39616324	missense	possibly damaging	0.91
R1318:Rims2	UTSW	15	39517826	missense	probably damaging	0.99
R1457:Rims2	UTSW	15	39511314	missense	possibly damaging	0.63
R1672:Rims2	UTSW	15	39292189	missense	probably benign	0.09
R1743:Rims2	UTSW	15	39679650	missense	probably benign	0.10
R1766:Rims2	UTSW	15	39462580	missense	probably damaging	0.99
R1779:Rims2	UTSW	15	39681702	missense	probably damaging	1.00
R1804:Rims2	UTSW	15	39437043	nonsense	probably null
R1985:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R1986:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R2113:Rims2	UTSW	15	39511326	missense	probably benign	0.17
R2260:Rims2	UTSW	15	39478566	nonsense	probably null
R2510:Rims2	UTSW	15	39585652	missense	probably damaging	1.00
R3693:Rims2	UTSW	15	39478575	missense	probably benign	0.01
R3937:Rims2	UTSW	15	39437845	missense	probably damaging	1.00
R4425:Rims2	UTSW	15	39437924	critical splice donor site	probably null
R4453:Rims2	UTSW	15	39292208	missense	probably damaging	1.00
R4474:Rims2	UTSW	15	39462560	missense	probably damaging	1.00
R4518:Rims2	UTSW	15	39437526	missense	probably damaging	1.00
R4526:Rims2	UTSW	15	39437717	missense	probably damaging	1.00
R4833:Rims2	UTSW	15	39535914	missense	probably damaging	0.98
R4936:Rims2	UTSW	15	39437728	missense	probably damaging	1.00
R4993:Rims2	UTSW	15	39454445	missense	possibly damaging	0.90
R5001:Rims2	UTSW	15	39452428	missense	probably benign	0.03
R5054:Rims2	UTSW	15	39517869	splice site	probably null
R5072:Rims2	UTSW	15	39462590	missense	probably benign	0.01
R5171:Rims2	UTSW	15	39437103	missense	probably damaging	1.00
R5429:Rims2	UTSW	15	39345355	missense	probably damaging	1.00
R5623:Rims2	UTSW	15	39478615	missense	probably damaging	1.00
R5624:Rims2	UTSW	15	39345413	missense	possibly damaging	0.46
R5685:Rims2	UTSW	15	39437206	missense	possibly damaging	0.67
R5784:Rims2	UTSW	15	39535987	splice site	probably null
R5790:Rims2	UTSW	15	39681045	missense	probably damaging	1.00
R5822:Rims2	UTSW	15	39476490	missense	probably damaging	1.00
R5963:Rims2	UTSW	15	39437182	missense	probably damaging	1.00
R5988:Rims2	UTSW	15	39292182	missense	probably damaging	1.00
R6057:Rims2	UTSW	15	39675020	missense	probably damaging	1.00
R6239:Rims2	UTSW	15	39198363	start codon destroyed	unknown
R6407:Rims2	UTSW	15	39452328	missense	probably damaging	1.00
R6418:Rims2	UTSW	15	39509696	missense	probably damaging	1.00
R6495:Rims2	UTSW	15	39517812	missense	probably benign	0.01
R6502:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R6753:Rims2	UTSW	15	39566973	missense	possibly damaging	0.74
R6855:Rims2	UTSW	15	39345515	missense	probably benign	0.06
R6948:Rims2	UTSW	15	39511341	missense	probably benign
R7058:Rims2	UTSW	15	39585648	missense	probably damaging	1.00
R7167:Rims2	UTSW	15	39437077	missense	probably benign
R7217:Rims2	UTSW	15	39476489	missense	probably damaging	0.99
R7223:Rims2	UTSW	15	39437032	missense	probably benign	0.30
R7289:Rims2	UTSW	15	39437718	missense	probably benign	0.00
R7459:Rims2	UTSW	15	39517839	missense	probably benign
R7663:Rims2	UTSW	15	39507026	missense	probably damaging	1.00
R7792:Rims2	UTSW	15	39198528	missense	possibly damaging	0.69
R7836:Rims2	UTSW	15	39681079	missense	probably damaging	1.00
R8082:Rims2	UTSW	15	39476523	missense	probably benign	0.34
R8489:Rims2	UTSW	15	39616450	missense	probably damaging	1.00
R8730:Rims2	UTSW	15	39517843	missense	probably benign	0.01
R8830:Rims2	UTSW	15	39437362	missense	possibly damaging	0.64
R8857:Rims2	UTSW	15	39679648	missense	possibly damaging	0.95
R8893:Rims2	UTSW	15	39534954	missense	probably benign	0.02
R9010:Rims2	UTSW	15	39452390	nonsense	probably null
R9030:Rims2	UTSW	15	39476477	missense	probably damaging	1.00
R9287:Rims2	UTSW	15	39679690	missense	probably damaging	1.00
R9395:Rims2	UTSW	15	39292269	missense	probably damaging	1.00
R9451:Rims2	UTSW	15	39437328	missense	probably damaging	1.00
R9506:Rims2	UTSW	15	39472436	missense	probably damaging	0.97
X0034:Rims2	UTSW	15	39437534	missense	probably benign
Z1177:Rims2	UTSW	15	39437769	missense	probably benign	0.24
Z1177:Rims2	UTSW	15	39478690	frame shift	probably null
Z1177:Rims2	UTSW	15	39681114	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTCTGCCTAAAGCATCTGGT -3'
(R):5'- ATTCAAATGACAGTGGTCTAAGTGCAGT -3'

Sequencing Primer
(F):5'- ACCTCCTGAAATGTCTGTGTAAACC -3'
(R):5'- acccaagaaaaccaatagaatagac -3'

Posted On

2014-04-24