Incidental Mutation 'R1619:Csmd3'
ID174566
Institutional Source Beutler Lab
Gene Symbol Csmd3
Ensembl Gene ENSMUSG00000022311
Gene NameCUB and Sushi multiple domains 3
Synonyms4930500N14Rik
MMRRC Submission 039656-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1619 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location47580637-48792063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47949950 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1062 (S1062L)
Ref Sequence ENSEMBL: ENSMUSP00000124753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100670] [ENSMUST00000160658] [ENSMUST00000162830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100670
AA Change: S1166L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098235
Gene: ENSMUSG00000022311
AA Change: S1166L

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110261
Predicted Effect probably damaging
Transcript: ENSMUST00000160658
AA Change: S1062L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124753
Gene: ENSMUSG00000022311
AA Change: S1062L

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
CCP 382 439 6.9e-14 SMART
CUB 444 555 9.22e-24 SMART
CCP 560 613 1.29e-13 SMART
CUB 617 725 6.87e-32 SMART
CCP 730 787 5.19e-9 SMART
CUB 791 899 3.23e-37 SMART
CCP 906 959 1.82e-13 SMART
CUB 963 1073 4.87e-23 SMART
CCP 1078 1133 1.82e-13 SMART
CUB 1137 1245 5.02e-25 SMART
CCP 1250 1306 2.5e-11 SMART
CUB 1310 1419 6.27e-26 SMART
CCP 1424 1480 4.41e-12 SMART
CUB 1484 1592 5.37e-34 SMART
CCP 1597 1654 1.18e-12 SMART
CUB 1658 1766 2.27e-23 SMART
CCP 1774 1831 1.84e-9 SMART
CUB 1835 1943 1.8e-35 SMART
CCP 1948 2003 4.48e-13 SMART
CUB 2007 2115 3.95e-32 SMART
CCP 2120 2175 4.02e-15 SMART
CUB 2179 2286 1.74e-33 SMART
CCP 2291 2348 5.82e-12 SMART
CUB 2353 2463 5.3e-24 SMART
CCP 2465 2523 2.11e-9 SMART
CCP 2528 2585 8.23e-12 SMART
CCP 2590 2643 1.14e-14 SMART
CCP 2648 2701 4.76e-17 SMART
CCP 2706 2759 1.85e-14 SMART
CCP 2764 2821 9.9e-15 SMART
CCP 2826 2879 1.79e-12 SMART
CCP 2887 2940 1.72e-14 SMART
CCP 2945 2999 3.17e-13 SMART
CCP 3004 3059 1.25e-11 SMART
CCP 3064 3117 1.25e-11 SMART
CCP 3122 3175 8.23e-12 SMART
CCP 3183 3237 5.6e-14 SMART
CCP 3242 3297 1.89e-11 SMART
transmembrane domain 3461 3483 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161653
AA Change: S325L
SMART Domains Protein: ENSMUSP00000124195
Gene: ENSMUSG00000022311
AA Change: S325L

DomainStartEndE-ValueType
CCP 1 51 6.59e-1 SMART
CUB 55 163 3.23e-37 SMART
CCP 170 223 1.82e-13 SMART
CUB 227 337 4.87e-23 SMART
CCP 342 397 1.82e-13 SMART
CUB 401 509 5.02e-25 SMART
CCP 514 570 2.5e-11 SMART
CUB 574 683 6.27e-26 SMART
CCP 688 744 4.41e-12 SMART
CUB 748 856 5.37e-34 SMART
CCP 861 918 1.18e-12 SMART
Pfam:CUB 922 964 9.7e-8 PFAM
CCP 968 1025 1.84e-9 SMART
CUB 1029 1137 1.8e-35 SMART
CCP 1142 1197 4.48e-13 SMART
CUB 1201 1309 3.95e-32 SMART
CCP 1314 1369 4.02e-15 SMART
CUB 1373 1480 1.74e-33 SMART
CCP 1485 1542 5.82e-12 SMART
CUB 1547 1657 5.3e-24 SMART
CCP 1659 1717 2.11e-9 SMART
CCP 1722 1779 8.23e-12 SMART
CCP 1784 1844 8.56e-10 SMART
CCP 1849 1902 1.14e-14 SMART
CCP 1907 1960 4.76e-17 SMART
CCP 1965 2018 1.85e-14 SMART
CCP 2023 2080 9.9e-15 SMART
CCP 2085 2138 1.79e-12 SMART
CCP 2146 2199 1.72e-14 SMART
CCP 2204 2258 3.17e-13 SMART
CCP 2263 2318 1.25e-11 SMART
CCP 2323 2376 1.25e-11 SMART
CCP 2381 2434 8.23e-12 SMART
CCP 2442 2496 5.6e-14 SMART
CCP 2501 2556 1.89e-11 SMART
transmembrane domain 2720 2742 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162830
AA Change: S1166L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124775
Gene: ENSMUSG00000022311
AA Change: S1166L

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,055 H1537L probably damaging Het
Actg2 T A 6: 83,523,187 N116I probably damaging Het
Actn1 G A 12: 80,173,022 H692Y probably damaging Het
Adamts6 C T 13: 104,312,777 P36S probably benign Het
Agr3 G A 12: 35,947,859 probably null Het
Ank3 T C 10: 69,879,975 V500A probably damaging Het
BC051019 T A 7: 109,718,062 D141V probably damaging Het
Bco1 T C 8: 117,108,715 F135S probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc42 A G 11: 68,594,289 K210E probably damaging Het
Cckar A T 5: 53,700,067 W263R probably damaging Het
Cela2a A G 4: 141,825,941 probably null Het
Cep97 A T 16: 55,927,796 N90K probably damaging Het
Ces2g A T 8: 104,967,352 Q440L probably damaging Het
Chchd6 G T 6: 89,419,754 T225K possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chrna5 A G 9: 55,004,365 T46A probably benign Het
Col16a1 G A 4: 130,098,940 G1531S probably damaging Het
Col19a1 A T 1: 24,534,091 V200E unknown Het
Csf2rb A G 15: 78,335,211 D2G probably damaging Het
Cul5 G T 9: 53,658,593 Q113K probably benign Het
Dmwd TAGCCTGGGAA TAGCCTGGGAAGCCTGGGAA 7: 19,081,034 probably benign Het
Dse T C 10: 34,153,234 D620G probably damaging Het
Dsg1c A G 18: 20,264,842 N33S probably benign Het
Epc2 G A 2: 49,549,978 V803I probably damaging Het
Erap1 T A 13: 74,671,381 H171Q probably damaging Het
Esrrb T C 12: 86,514,500 V336A possibly damaging Het
Fech A T 18: 64,462,118 W300R probably damaging Het
Fgd4 T C 16: 16,424,056 I635V possibly damaging Het
Galc A T 12: 98,234,304 N282K probably benign Het
Gpat2 A G 2: 127,428,717 Y95C probably benign Het
Grm2 T A 9: 106,647,471 I682F probably damaging Het
Hdac10 G T 15: 89,126,675 A241D probably damaging Het
Helz T A 11: 107,636,279 C182* probably null Het
Ift140 A G 17: 25,088,865 Y978C probably damaging Het
Intu T A 3: 40,697,631 C839* probably null Het
Jmjd1c T C 10: 67,219,875 V358A probably benign Het
Kif26b A G 1: 178,916,478 S1380G probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Lrrc2 T A 9: 110,960,973 S99R probably benign Het
Mrpl48 G A 7: 100,546,275 probably benign Het
Mup9 A G 4: 60,421,879 probably benign Het
Nap1l1 G A 10: 111,493,379 V285I possibly damaging Het
Nepro A G 16: 44,727,028 D36G probably benign Het
Nkain4 A G 2: 180,936,001 F187L probably damaging Het
Nobox A T 6: 43,307,467 C82S possibly damaging Het
Ntn4 C A 10: 93,644,734 Q70K probably damaging Het
Olfr1281 A G 2: 111,328,961 I181V probably benign Het
Olfr1484 T A 19: 13,585,614 F103L probably benign Het
Olfr385 A T 11: 73,589,292 W149R probably damaging Het
Olfr644 T C 7: 104,068,531 R167G probably damaging Het
Olfr71 A G 4: 43,706,292 I92T probably damaging Het
Olfr823 A G 10: 130,112,679 I37T possibly damaging Het
Pappa A G 4: 65,176,229 E497G probably damaging Het
Pard3 C A 8: 127,380,502 T569K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh10 A G 3: 45,380,312 N354D possibly damaging Het
Pdgfc T C 3: 81,174,887 V129A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Phf20l1 A T 15: 66,615,259 H407L possibly damaging Het
Phip A T 9: 82,871,449 D1747E probably benign Het
Pkd1l1 A G 11: 8,950,413 S43P probably damaging Het
Plekhg2 T C 7: 28,368,421 E202G probably damaging Het
Rapsn A G 2: 91,043,159 D270G possibly damaging Het
Rims2 A C 15: 39,506,986 S939R probably damaging Het
Ripor3 T C 2: 167,980,845 D932G probably damaging Het
Rtp2 A T 16: 23,930,671 W30R probably damaging Het
Scgb2b27 A T 7: 34,012,132 D97E probably benign Het
Slc25a46 T C 18: 31,583,489 N320S probably benign Het
Slc9b1 A G 3: 135,355,004 probably null Het
Socs4 T A 14: 47,290,283 M225K possibly damaging Het
Spata31d1a A T 13: 59,702,433 L627* probably null Het
Srcin1 A G 11: 97,525,481 L975P probably damaging Het
Stard3 T A 11: 98,376,609 probably null Het
Susd2 G T 10: 75,638,044 S572R possibly damaging Het
Tll1 C A 8: 64,056,273 A568S probably benign Het
Tmem132a C G 19: 10,861,698 G460A probably damaging Het
Trim62 A G 4: 128,909,488 K444E probably damaging Het
Trpm3 A G 19: 22,711,907 T67A probably damaging Het
Ttc6 T C 12: 57,737,668 M1841T possibly damaging Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Vmn2r38 C A 7: 9,075,533 V617L probably damaging Het
Xkr6 G A 14: 63,819,317 V226M probably benign Het
Zfp940 G A 7: 29,845,537 A315V possibly damaging Het
Zfr C A 15: 12,150,387 T480K possibly damaging Het
Other mutations in Csmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Csmd3 APN 15 48287495 missense possibly damaging 0.61
IGL00591:Csmd3 APN 15 48004883 missense probably damaging 1.00
IGL00668:Csmd3 APN 15 47913945 missense probably damaging 1.00
IGL00753:Csmd3 APN 15 47644235 missense probably damaging 1.00
IGL00773:Csmd3 APN 15 47590719 missense probably damaging 0.96
IGL00926:Csmd3 APN 15 47710964 missense possibly damaging 0.87
IGL00942:Csmd3 APN 15 47847106 critical splice donor site probably null
IGL01080:Csmd3 APN 15 47881403 missense probably benign 0.12
IGL01314:Csmd3 APN 15 47849755 missense probably damaging 1.00
IGL01326:Csmd3 APN 15 47849785 missense probably benign 0.06
IGL01393:Csmd3 APN 15 48457599 missense possibly damaging 0.88
IGL01432:Csmd3 APN 15 47733499 missense probably damaging 1.00
IGL01519:Csmd3 APN 15 47596850 missense probably benign 0.31
IGL01530:Csmd3 APN 15 47838437 missense possibly damaging 0.95
IGL01530:Csmd3 APN 15 47669617 missense probably damaging 1.00
IGL01547:Csmd3 APN 15 47883617 missense probably benign 0.41
IGL01594:Csmd3 APN 15 47629239 missense probably benign 0.01
IGL01618:Csmd3 APN 15 48011083 missense probably benign 0.05
IGL01670:Csmd3 APN 15 47611829 missense probably damaging 1.00
IGL01680:Csmd3 APN 15 47970030 missense probably damaging 1.00
IGL01734:Csmd3 APN 15 48185304 missense probably damaging 1.00
IGL01777:Csmd3 APN 15 47698198 missense probably benign 0.06
IGL01779:Csmd3 APN 15 47857894 missense probably benign 0.10
IGL01820:Csmd3 APN 15 47607142 nonsense probably null
IGL01843:Csmd3 APN 15 47658999 splice site probably benign
IGL01919:Csmd3 APN 15 47675772 missense possibly damaging 0.62
IGL01986:Csmd3 APN 15 47659195 missense possibly damaging 0.82
IGL02049:Csmd3 APN 15 48001474 missense possibly damaging 0.91
IGL02065:Csmd3 APN 15 47666628 missense probably damaging 1.00
IGL02112:Csmd3 APN 15 48313869 missense possibly damaging 0.95
IGL02133:Csmd3 APN 15 47857942 missense possibly damaging 0.86
IGL02203:Csmd3 APN 15 47849677 splice site probably null
IGL02215:Csmd3 APN 15 47585688 missense probably damaging 1.00
IGL02234:Csmd3 APN 15 47948116 missense probably damaging 1.00
IGL02326:Csmd3 APN 15 47755963 splice site probably benign
IGL02478:Csmd3 APN 15 47838398 splice site probably benign
IGL02491:Csmd3 APN 15 47914115 splice site probably benign
IGL02598:Csmd3 APN 15 47669690 missense probably damaging 0.98
IGL02626:Csmd3 APN 15 47704107 splice site probably benign
IGL02696:Csmd3 APN 15 47669669 missense probably benign 0.33
IGL02876:Csmd3 APN 15 47606096 splice site probably benign
IGL02971:Csmd3 APN 15 47913929 splice site probably benign
IGL03068:Csmd3 APN 15 47847121 missense possibly damaging 0.69
IGL03087:Csmd3 APN 15 47977033 missense probably damaging 1.00
IGL03114:Csmd3 APN 15 47820451 missense probably damaging 0.99
IGL03146:Csmd3 APN 15 47881477 missense probably benign 0.25
IGL03193:Csmd3 APN 15 47629230 splice site probably benign
IGL03274:Csmd3 APN 15 47645504 missense probably damaging 1.00
R0040:Csmd3 UTSW 15 47633816 missense probably damaging 1.00
R0071:Csmd3 UTSW 15 47596821 missense probably benign 0.04
R0071:Csmd3 UTSW 15 47596821 missense probably benign 0.04
R0119:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0124:Csmd3 UTSW 15 47590716 missense probably damaging 1.00
R0127:Csmd3 UTSW 15 47981930 missense probably benign 0.45
R0136:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0201:Csmd3 UTSW 15 47619729 splice site probably benign
R0240:Csmd3 UTSW 15 47629239 missense probably benign 0.05
R0240:Csmd3 UTSW 15 47629239 missense probably benign 0.05
R0318:Csmd3 UTSW 15 47659153 missense probably damaging 1.00
R0369:Csmd3 UTSW 15 47970147 missense probably damaging 1.00
R0391:Csmd3 UTSW 15 47657573 missense probably damaging 1.00
R0499:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0506:Csmd3 UTSW 15 48457511 missense probably benign 0.00
R0606:Csmd3 UTSW 15 48457662 missense probably benign
R0639:Csmd3 UTSW 15 47913940 missense probably damaging 1.00
R0658:Csmd3 UTSW 15 48011147 missense possibly damaging 0.66
R0673:Csmd3 UTSW 15 47913940 missense probably damaging 1.00
R0689:Csmd3 UTSW 15 47756025 missense probably benign 0.19
R0696:Csmd3 UTSW 15 47847173 missense probably benign 0.01
R0799:Csmd3 UTSW 15 48185384 splice site probably benign
R0834:Csmd3 UTSW 15 47883677 intron probably benign
R0894:Csmd3 UTSW 15 47857920 missense possibly damaging 0.95
R0926:Csmd3 UTSW 15 47977033 missense probably damaging 1.00
R0943:Csmd3 UTSW 15 47675739 missense probably damaging 0.99
R0944:Csmd3 UTSW 15 47611831 missense probably damaging 1.00
R0967:Csmd3 UTSW 15 47857831 missense probably null 0.89
R0973:Csmd3 UTSW 15 47659089 missense probably damaging 1.00
R1055:Csmd3 UTSW 15 47881537 missense probably damaging 1.00
R1066:Csmd3 UTSW 15 47913965 missense probably damaging 1.00
R1086:Csmd3 UTSW 15 47695755 missense probably damaging 0.99
R1103:Csmd3 UTSW 15 47948006 missense probably damaging 1.00
R1136:Csmd3 UTSW 15 47675817 missense probably damaging 1.00
R1139:Csmd3 UTSW 15 47695836 missense probably damaging 1.00
R1158:Csmd3 UTSW 15 48292774 splice site probably null
R1215:Csmd3 UTSW 15 48004831 unclassified probably null
R1233:Csmd3 UTSW 15 48673531 missense probably damaging 1.00
R1271:Csmd3 UTSW 15 48011059 missense probably benign 0.11
R1469:Csmd3 UTSW 15 47669202 nonsense probably null
R1469:Csmd3 UTSW 15 47669202 nonsense probably null
R1479:Csmd3 UTSW 15 47857886 missense probably damaging 1.00
R1480:Csmd3 UTSW 15 47731929 missense possibly damaging 0.90
R1526:Csmd3 UTSW 15 47585632 critical splice donor site probably null
R1527:Csmd3 UTSW 15 47948087 missense probably benign 0.08
R1539:Csmd3 UTSW 15 47820398 missense probably benign 0.24
R1544:Csmd3 UTSW 15 47611898 splice site probably null
R1548:Csmd3 UTSW 15 47981975 missense possibly damaging 0.91
R1574:Csmd3 UTSW 15 47695861 splice site probably null
R1574:Csmd3 UTSW 15 47695861 splice site probably null
R1630:Csmd3 UTSW 15 47838522 missense possibly damaging 0.66
R1665:Csmd3 UTSW 15 47696789 missense probably damaging 1.00
R1680:Csmd3 UTSW 15 47741170 missense probably damaging 1.00
R1725:Csmd3 UTSW 15 47596807 missense probably damaging 1.00
R1743:Csmd3 UTSW 15 48622089 missense probably damaging 1.00
R1749:Csmd3 UTSW 15 47585660 missense probably damaging 1.00
R1752:Csmd3 UTSW 15 47660273 missense probably benign 0.15
R1769:Csmd3 UTSW 15 47704109 splice site probably benign
R1775:Csmd3 UTSW 15 47899739 missense probably damaging 0.99
R1795:Csmd3 UTSW 15 47857920 missense possibly damaging 0.95
R1819:Csmd3 UTSW 15 47753735 missense possibly damaging 0.56
R1840:Csmd3 UTSW 15 47607164 missense probably damaging 1.00
R1860:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R1861:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R1879:Csmd3 UTSW 15 47657519 missense possibly damaging 0.90
R1958:Csmd3 UTSW 15 48004639 critical splice donor site probably null
R1965:Csmd3 UTSW 15 47849748 missense probably benign 0.15
R1970:Csmd3 UTSW 15 48673531 missense probably damaging 1.00
R2029:Csmd3 UTSW 15 47838579 missense probably damaging 1.00
R2051:Csmd3 UTSW 15 48621993 critical splice donor site probably null
R2108:Csmd3 UTSW 15 48004861 missense possibly damaging 0.81
R2132:Csmd3 UTSW 15 48457503 missense probably benign 0.06
R2146:Csmd3 UTSW 15 47741236 frame shift probably null
R2147:Csmd3 UTSW 15 47741236 frame shift probably null
R2148:Csmd3 UTSW 15 47741236 frame shift probably null
R2157:Csmd3 UTSW 15 47695787 missense probably damaging 0.99
R2159:Csmd3 UTSW 15 47741236 frame shift probably null
R2160:Csmd3 UTSW 15 47741236 frame shift probably null
R2161:Csmd3 UTSW 15 47741236 frame shift probably null
R2162:Csmd3 UTSW 15 47741236 frame shift probably null
R2164:Csmd3 UTSW 15 47741236 frame shift probably null
R2213:Csmd3 UTSW 15 47820447 missense possibly damaging 0.92
R2301:Csmd3 UTSW 15 47731998 missense probably damaging 1.00
R2302:Csmd3 UTSW 15 48314051 missense probably benign
R2355:Csmd3 UTSW 15 47741236 frame shift probably null
R2497:Csmd3 UTSW 15 47741236 frame shift probably null
R2509:Csmd3 UTSW 15 47741236 frame shift probably null
R2566:Csmd3 UTSW 15 47741236 frame shift probably null
R2567:Csmd3 UTSW 15 47741236 frame shift probably null
R2568:Csmd3 UTSW 15 47741236 frame shift probably null
R2570:Csmd3 UTSW 15 47741236 frame shift probably null
R2571:Csmd3 UTSW 15 47741236 frame shift probably null
R2870:Csmd3 UTSW 15 47857924 missense probably damaging 1.00
R2870:Csmd3 UTSW 15 47857924 missense probably damaging 1.00
R2907:Csmd3 UTSW 15 48011053 missense probably damaging 0.99
R3116:Csmd3 UTSW 15 47657599 missense probably damaging 1.00
R3423:Csmd3 UTSW 15 47847252 missense probably damaging 0.98
R3425:Csmd3 UTSW 15 47847252 missense probably damaging 0.98
R3508:Csmd3 UTSW 15 47741236 frame shift probably null
R3746:Csmd3 UTSW 15 47849766 missense probably benign 0.04
R3813:Csmd3 UTSW 15 48791813 missense possibly damaging 0.82
R3832:Csmd3 UTSW 15 47741236 frame shift probably null
R3959:Csmd3 UTSW 15 47644189 missense probably benign 0.18
R4042:Csmd3 UTSW 15 47614084 missense probably damaging 1.00
R4043:Csmd3 UTSW 15 47755966 critical splice donor site probably null
R4191:Csmd3 UTSW 15 47847271 missense probably damaging 0.99
R4192:Csmd3 UTSW 15 47847271 missense probably damaging 0.99
R4419:Csmd3 UTSW 15 47704311 missense probably damaging 1.00
R4426:Csmd3 UTSW 15 47669185 missense possibly damaging 0.51
R4434:Csmd3 UTSW 15 47899795 missense possibly damaging 0.68
R4438:Csmd3 UTSW 15 47899795 missense possibly damaging 0.68
R4490:Csmd3 UTSW 15 48314033 missense possibly damaging 0.83
R4562:Csmd3 UTSW 15 47899844 missense probably benign 0.32
R4604:Csmd3 UTSW 15 48004815 missense possibly damaging 0.90
R4620:Csmd3 UTSW 15 47585753 missense probably benign 0.09
R4632:Csmd3 UTSW 15 48011209 missense probably damaging 0.99
R4679:Csmd3 UTSW 15 48161083 nonsense probably null
R4696:Csmd3 UTSW 15 47913968 missense probably benign 0.24
R4718:Csmd3 UTSW 15 47698150 nonsense probably null
R4723:Csmd3 UTSW 15 47669160 missense probably benign 0.29
R4801:Csmd3 UTSW 15 47621292 missense probably damaging 1.00
R4802:Csmd3 UTSW 15 47621292 missense probably damaging 1.00
R4806:Csmd3 UTSW 15 48314068 missense probably benign
R4816:Csmd3 UTSW 15 47857934 missense possibly damaging 0.68
R4935:Csmd3 UTSW 15 48161084 missense probably damaging 1.00
R4955:Csmd3 UTSW 15 48673518 missense probably damaging 0.99
R4991:Csmd3 UTSW 15 48001478 missense probably damaging 1.00
R5031:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R5034:Csmd3 UTSW 15 47629287 missense possibly damaging 0.94
R5035:Csmd3 UTSW 15 47590779 missense probably damaging 1.00
R5120:Csmd3 UTSW 15 48673495 nonsense probably null
R5224:Csmd3 UTSW 15 47888684 missense possibly damaging 0.91
R5235:Csmd3 UTSW 15 47629278 missense probably benign 0.20
R5279:Csmd3 UTSW 15 48791944 unclassified probably null
R5360:Csmd3 UTSW 15 47669203 missense probably damaging 0.99
R5365:Csmd3 UTSW 15 48004749 missense possibly damaging 0.68
R5379:Csmd3 UTSW 15 47636450 nonsense probably null
R5381:Csmd3 UTSW 15 47741215 missense probably benign 0.21
R5393:Csmd3 UTSW 15 47633703 missense probably damaging 1.00
R5413:Csmd3 UTSW 15 47838435 missense probably damaging 1.00
R5549:Csmd3 UTSW 15 48185357 missense probably damaging 0.98
R5550:Csmd3 UTSW 15 48185357 missense probably damaging 0.98
R5551:Csmd3 UTSW 15 48314096 missense probably benign 0.13
R5567:Csmd3 UTSW 15 47645468 missense possibly damaging 0.92
R5621:Csmd3 UTSW 15 48313978 missense possibly damaging 0.84
R5668:Csmd3 UTSW 15 47695755 missense possibly damaging 0.48
R5677:Csmd3 UTSW 15 48622051 missense probably damaging 0.98
R5701:Csmd3 UTSW 15 47650221 missense probably damaging 1.00
R5701:Csmd3 UTSW 15 48540333 missense probably damaging 0.99
R5871:Csmd3 UTSW 15 47888716 missense probably damaging 0.98
R5872:Csmd3 UTSW 15 47582527 missense probably damaging 1.00
R5874:Csmd3 UTSW 15 47644270 missense probably damaging 1.00
R5952:Csmd3 UTSW 15 47733505 missense probably damaging 0.98
R5956:Csmd3 UTSW 15 48791882 missense possibly damaging 0.84
R5966:Csmd3 UTSW 15 47849739 missense probably damaging 0.96
R5969:Csmd3 UTSW 15 47947990 missense probably damaging 1.00
R5989:Csmd3 UTSW 15 47590764 missense possibly damaging 0.69
R6017:Csmd3 UTSW 15 48314012 missense possibly damaging 0.95
R6057:Csmd3 UTSW 15 47755391 missense probably damaging 1.00
R6127:Csmd3 UTSW 15 47650228 missense probably damaging 1.00
R6178:Csmd3 UTSW 15 48673458 missense probably damaging 1.00
R6198:Csmd3 UTSW 15 48313877 missense probably benign 0.28
R6213:Csmd3 UTSW 15 47629260 missense probably damaging 1.00
R6256:Csmd3 UTSW 15 47669729 missense probably damaging 1.00
R6274:Csmd3 UTSW 15 47621437 missense probably benign
R6327:Csmd3 UTSW 15 47881387 missense probably damaging 1.00
R6354:Csmd3 UTSW 15 47881489 missense probably damaging 1.00
R6405:Csmd3 UTSW 15 47820371 missense probably damaging 0.99
R6410:Csmd3 UTSW 15 48673407 missense probably damaging 1.00
R6416:Csmd3 UTSW 15 48673560 missense probably damaging 1.00
R6463:Csmd3 UTSW 15 47676479 missense probably damaging 1.00
R6536:Csmd3 UTSW 15 47838467 missense probably damaging 1.00
R6625:Csmd3 UTSW 15 47607075 missense probably benign 0.02
R6695:Csmd3 UTSW 15 47857834 missense probably damaging 0.99
R6895:Csmd3 UTSW 15 47666514 splice site probably null
R6906:Csmd3 UTSW 15 47847173 missense probably benign 0.01
R6914:Csmd3 UTSW 15 48011138 missense possibly damaging 0.53
R6920:Csmd3 UTSW 15 47644205 missense probably damaging 1.00
R7024:Csmd3 UTSW 15 47710991 missense probably damaging 1.00
R7178:Csmd3 UTSW 15 47590774 missense
R7192:Csmd3 UTSW 15 47704237 missense
R7220:Csmd3 UTSW 15 48457598 missense probably damaging 0.99
R7362:Csmd3 UTSW 15 47755992 missense possibly damaging 0.65
R7380:Csmd3 UTSW 15 47586965 missense
R7397:Csmd3 UTSW 15 47695734 missense
R7467:Csmd3 UTSW 15 47629244 missense
R7585:Csmd3 UTSW 15 48622075 missense possibly damaging 0.76
R7623:Csmd3 UTSW 15 47949938 missense
R7649:Csmd3 UTSW 15 47669143 missense
R7691:Csmd3 UTSW 15 47741173 missense
R7695:Csmd3 UTSW 15 47820381 missense
U24488:Csmd3 UTSW 15 47710399 missense probably damaging 1.00
V8831:Csmd3 UTSW 15 48457696 missense probably damaging 0.96
X0021:Csmd3 UTSW 15 47970093 nonsense probably null
Z1088:Csmd3 UTSW 15 47636393 missense probably damaging 1.00
Z1088:Csmd3 UTSW 15 47847281 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAAGGCATTTCCGTTCTTGCTGAG -3'
(R):5'- TAAAGACCCGAGGTTGACAGCCAC -3'

Sequencing Primer
(F):5'- CCGTTCTTGCTGAGAGGTTAG -3'
(R):5'- GAGGTTGACAGCCACTTTCAATAG -3'
Posted On2014-04-24