Incidental Mutation 'R1619:Trpm3'
Institutional Source Beutler Lab
Gene Symbol Trpm3
Ensembl Gene ENSMUSG00000052387
Gene Nametransient receptor potential cation channel, subfamily M, member 3
SynonymsB930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3
MMRRC Submission 039656-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1619 (G1)
Quality Score225
Status Not validated
Chromosomal Location22139119-22989884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22711907 bp
Amino Acid Change Threonine to Alanine at position 67 (T67A)
Ref Sequence ENSEMBL: ENSMUSP00000097162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099564] [ENSMUST00000099566] [ENSMUST00000099569]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037901
AA Change: T220A

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387
AA Change: T220A

Blast:ANK 485 514 1e-6 BLAST
low complexity region 619 631 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 788 800 N/A INTRINSIC
low complexity region 821 840 N/A INTRINSIC
Pfam:Ion_trans 883 1136 1.7e-19 PFAM
Pfam:TRPM_tetra 1227 1282 1.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074770
AA Change: T222A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: T222A

low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 611 623 N/A INTRINSIC
low complexity region 666 681 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 813 832 N/A INTRINSIC
transmembrane domain 874 896 N/A INTRINSIC
Pfam:Ion_trans 908 1116 5.1e-14 PFAM
low complexity region 1378 1388 N/A INTRINSIC
low complexity region 1433 1455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087576
AA Change: T222A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: T222A

low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 621 633 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 790 802 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
Pfam:Ion_trans 918 1126 5.1e-14 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099564
AA Change: T67A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097160
Gene: ENSMUSG00000052387
AA Change: T67A

low complexity region 451 463 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 653 672 N/A INTRINSIC
transmembrane domain 714 736 N/A INTRINSIC
Pfam:Ion_trans 748 919 1.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099566
AA Change: T67A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000099569
AA Change: T222A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: T222A

low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 6e-7 BLAST
low complexity region 609 621 N/A INTRINSIC
low complexity region 664 679 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
Pfam:Ion_trans 873 1138 3.2e-19 PFAM
Pfam:TRPM_tetra 1229 1284 4.4e-26 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,055 H1537L probably damaging Het
Actg2 T A 6: 83,523,187 N116I probably damaging Het
Actn1 G A 12: 80,173,022 H692Y probably damaging Het
Adamts6 C T 13: 104,312,777 P36S probably benign Het
Agr3 G A 12: 35,947,859 probably null Het
Ank3 T C 10: 69,879,975 V500A probably damaging Het
BC051019 T A 7: 109,718,062 D141V probably damaging Het
Bco1 T C 8: 117,108,715 F135S probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc42 A G 11: 68,594,289 K210E probably damaging Het
Cckar A T 5: 53,700,067 W263R probably damaging Het
Cela2a A G 4: 141,825,941 probably null Het
Cep97 A T 16: 55,927,796 N90K probably damaging Het
Ces2g A T 8: 104,967,352 Q440L probably damaging Het
Chchd6 G T 6: 89,419,754 T225K possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chrna5 A G 9: 55,004,365 T46A probably benign Het
Col16a1 G A 4: 130,098,940 G1531S probably damaging Het
Col19a1 A T 1: 24,534,091 V200E unknown Het
Csf2rb A G 15: 78,335,211 D2G probably damaging Het
Csmd3 G A 15: 47,949,950 S1062L probably damaging Het
Cul5 G T 9: 53,658,593 Q113K probably benign Het
Dmwd TAGCCTGGGAA TAGCCTGGGAAGCCTGGGAA 7: 19,081,034 probably benign Het
Dse T C 10: 34,153,234 D620G probably damaging Het
Dsg1c A G 18: 20,264,842 N33S probably benign Het
Epc2 G A 2: 49,549,978 V803I probably damaging Het
Erap1 T A 13: 74,671,381 H171Q probably damaging Het
Esrrb T C 12: 86,514,500 V336A possibly damaging Het
Fech A T 18: 64,462,118 W300R probably damaging Het
Fgd4 T C 16: 16,424,056 I635V possibly damaging Het
Galc A T 12: 98,234,304 N282K probably benign Het
Gpat2 A G 2: 127,428,717 Y95C probably benign Het
Grm2 T A 9: 106,647,471 I682F probably damaging Het
Hdac10 G T 15: 89,126,675 A241D probably damaging Het
Helz T A 11: 107,636,279 C182* probably null Het
Ift140 A G 17: 25,088,865 Y978C probably damaging Het
Intu T A 3: 40,697,631 C839* probably null Het
Jmjd1c T C 10: 67,219,875 V358A probably benign Het
Kif26b A G 1: 178,916,478 S1380G probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Lrrc2 T A 9: 110,960,973 S99R probably benign Het
Mrpl48 G A 7: 100,546,275 probably benign Het
Mup9 A G 4: 60,421,879 probably benign Het
Nap1l1 G A 10: 111,493,379 V285I possibly damaging Het
Nepro A G 16: 44,727,028 D36G probably benign Het
Nkain4 A G 2: 180,936,001 F187L probably damaging Het
Nobox A T 6: 43,307,467 C82S possibly damaging Het
Ntn4 C A 10: 93,644,734 Q70K probably damaging Het
Olfr1281 A G 2: 111,328,961 I181V probably benign Het
Olfr1484 T A 19: 13,585,614 F103L probably benign Het
Olfr385 A T 11: 73,589,292 W149R probably damaging Het
Olfr644 T C 7: 104,068,531 R167G probably damaging Het
Olfr71 A G 4: 43,706,292 I92T probably damaging Het
Olfr823 A G 10: 130,112,679 I37T possibly damaging Het
Pappa A G 4: 65,176,229 E497G probably damaging Het
Pard3 C A 8: 127,380,502 T569K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh10 A G 3: 45,380,312 N354D possibly damaging Het
Pdgfc T C 3: 81,174,887 V129A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Phf20l1 A T 15: 66,615,259 H407L possibly damaging Het
Phip A T 9: 82,871,449 D1747E probably benign Het
Pkd1l1 A G 11: 8,950,413 S43P probably damaging Het
Plekhg2 T C 7: 28,368,421 E202G probably damaging Het
Rapsn A G 2: 91,043,159 D270G possibly damaging Het
Rims2 A C 15: 39,506,986 S939R probably damaging Het
Ripor3 T C 2: 167,980,845 D932G probably damaging Het
Rtp2 A T 16: 23,930,671 W30R probably damaging Het
Scgb2b27 A T 7: 34,012,132 D97E probably benign Het
Slc25a46 T C 18: 31,583,489 N320S probably benign Het
Slc9b1 A G 3: 135,355,004 probably null Het
Socs4 T A 14: 47,290,283 M225K possibly damaging Het
Spata31d1a A T 13: 59,702,433 L627* probably null Het
Srcin1 A G 11: 97,525,481 L975P probably damaging Het
Stard3 T A 11: 98,376,609 probably null Het
Susd2 G T 10: 75,638,044 S572R possibly damaging Het
Tll1 C A 8: 64,056,273 A568S probably benign Het
Tmem132a C G 19: 10,861,698 G460A probably damaging Het
Trim62 A G 4: 128,909,488 K444E probably damaging Het
Ttc6 T C 12: 57,737,668 M1841T possibly damaging Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Vmn2r38 C A 7: 9,075,533 V617L probably damaging Het
Xkr6 G A 14: 63,819,317 V226M probably benign Het
Zfp940 G A 7: 29,845,537 A315V possibly damaging Het
Zfr C A 15: 12,150,387 T480K possibly damaging Het
Other mutations in Trpm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Trpm3 APN 19 22987659 missense probably benign 0.00
IGL00773:Trpm3 APN 19 22900159 missense possibly damaging 0.92
IGL00852:Trpm3 APN 19 22987071 missense possibly damaging 0.93
IGL01597:Trpm3 APN 19 22715246 missense probably damaging 1.00
IGL01607:Trpm3 APN 19 22987127 missense probably benign 0.01
IGL01818:Trpm3 APN 19 22914474 missense probably damaging 1.00
IGL01890:Trpm3 APN 19 22711719 missense probably damaging 0.98
IGL02016:Trpm3 APN 19 22902069 nonsense probably null
IGL02324:Trpm3 APN 19 22698779 missense probably benign 0.25
IGL02947:Trpm3 APN 19 22901119 missense probably damaging 0.99
IGL03037:Trpm3 APN 19 22889412 missense possibly damaging 0.85
IGL03128:Trpm3 APN 19 22914465 missense probably damaging 1.00
IGL03335:Trpm3 APN 19 22926071 critical splice donor site probably null
IGL03354:Trpm3 APN 19 22856718 missense probably damaging 1.00
bit UTSW 19 22987869 missense probably benign 0.00
P0041:Trpm3 UTSW 19 22897686 missense probably benign 0.01
R0001:Trpm3 UTSW 19 22715331 missense possibly damaging 0.70
R0007:Trpm3 UTSW 19 22987529 missense probably benign 0.00
R0007:Trpm3 UTSW 19 22987529 missense probably benign 0.00
R0009:Trpm3 UTSW 19 22914446 missense probably damaging 1.00
R0009:Trpm3 UTSW 19 22914446 missense probably damaging 1.00
R0142:Trpm3 UTSW 19 22987916 missense probably damaging 0.98
R0194:Trpm3 UTSW 19 22715356 splice site probably null
R0268:Trpm3 UTSW 19 22897521 critical splice donor site probably null
R0299:Trpm3 UTSW 19 22986873 missense possibly damaging 0.62
R0449:Trpm3 UTSW 19 22988054 missense probably benign
R0481:Trpm3 UTSW 19 22901071 missense possibly damaging 0.51
R0496:Trpm3 UTSW 19 22698778 missense probably benign 0.00
R0499:Trpm3 UTSW 19 22986873 missense possibly damaging 0.62
R0550:Trpm3 UTSW 19 22987812 missense probably damaging 0.97
R0729:Trpm3 UTSW 19 22987789 missense probably benign
R0883:Trpm3 UTSW 19 22978654 missense probably damaging 1.00
R0926:Trpm3 UTSW 19 22988043 missense probably benign 0.02
R1185:Trpm3 UTSW 19 22914417 splice site probably benign
R1185:Trpm3 UTSW 19 22914417 splice site probably benign
R1513:Trpm3 UTSW 19 22986872 missense possibly damaging 0.96
R1521:Trpm3 UTSW 19 22901221 missense probably damaging 1.00
R1522:Trpm3 UTSW 19 22978334 missense probably benign 0.39
R1569:Trpm3 UTSW 19 22889445 critical splice donor site probably null
R1598:Trpm3 UTSW 19 22733024 missense possibly damaging 0.47
R1600:Trpm3 UTSW 19 22139155 missense probably benign 0.00
R1616:Trpm3 UTSW 19 22982712 missense probably damaging 1.00
R1923:Trpm3 UTSW 19 22885412 missense probably damaging 1.00
R1985:Trpm3 UTSW 19 22926082 missense possibly damaging 0.56
R2002:Trpm3 UTSW 19 22982583 missense probably damaging 1.00
R2249:Trpm3 UTSW 19 22733034 missense probably benign 0.15
R3719:Trpm3 UTSW 19 22986990 missense possibly damaging 0.95
R3766:Trpm3 UTSW 19 22448377 missense probably benign
R3774:Trpm3 UTSW 19 22978602 missense possibly damaging 0.66
R3774:Trpm3 UTSW 19 22987975 missense probably benign 0.03
R3776:Trpm3 UTSW 19 22978602 missense possibly damaging 0.66
R3820:Trpm3 UTSW 19 22987449 missense probably benign 0.00
R3899:Trpm3 UTSW 19 22901160 missense possibly damaging 0.90
R4204:Trpm3 UTSW 19 22987564 missense probably benign 0.00
R4238:Trpm3 UTSW 19 22978638 missense probably damaging 1.00
R4301:Trpm3 UTSW 19 22987292 missense probably benign 0.23
R4344:Trpm3 UTSW 19 22897697 missense probably damaging 0.99
R4345:Trpm3 UTSW 19 22897697 missense probably damaging 0.99
R4365:Trpm3 UTSW 19 22978330 missense probably benign 0.00
R4510:Trpm3 UTSW 19 22988017 missense probably benign 0.00
R4511:Trpm3 UTSW 19 22988017 missense probably benign 0.00
R4565:Trpm3 UTSW 19 22987869 missense probably benign 0.00
R4573:Trpm3 UTSW 19 22902142 missense probably damaging 1.00
R4606:Trpm3 UTSW 19 22978624 missense probably benign 0.26
R4677:Trpm3 UTSW 19 22987388 missense possibly damaging 0.95
R4684:Trpm3 UTSW 19 22987781 missense probably benign
R4713:Trpm3 UTSW 19 22889435 missense possibly damaging 0.83
R4745:Trpm3 UTSW 19 22715295 missense possibly damaging 0.67
R5015:Trpm3 UTSW 19 22711712 missense probably damaging 1.00
R5030:Trpm3 UTSW 19 22698766 missense probably benign 0.01
R5074:Trpm3 UTSW 19 22885349 missense possibly damaging 0.65
R5089:Trpm3 UTSW 19 22766756 missense probably damaging 0.97
R5100:Trpm3 UTSW 19 22918766 missense probably damaging 0.99
R5108:Trpm3 UTSW 19 22904714 missense probably benign 0.06
R5204:Trpm3 UTSW 19 22448341 nonsense probably null
R5213:Trpm3 UTSW 19 22697454 nonsense probably null
R5358:Trpm3 UTSW 19 22925968 missense probably damaging 1.00
R5374:Trpm3 UTSW 19 22926184 nonsense probably null
R5382:Trpm3 UTSW 19 22885341 splice site probably null
R5509:Trpm3 UTSW 19 22987258 missense probably damaging 0.99
R5558:Trpm3 UTSW 19 22978573 missense probably damaging 1.00
R6154:Trpm3 UTSW 19 22987814 missense probably damaging 1.00
R6250:Trpm3 UTSW 19 22910054 missense probably benign 0.01
R6433:Trpm3 UTSW 19 22901305 missense probably damaging 1.00
R6542:Trpm3 UTSW 19 22926113 missense probably benign 0.04
R6630:Trpm3 UTSW 19 22987983 missense probably benign 0.00
R6640:Trpm3 UTSW 19 22978582 missense probably damaging 1.00
R6725:Trpm3 UTSW 19 22926028 missense probably damaging 1.00
R7275:Trpm3 UTSW 19 22978684 missense possibly damaging 0.71
R7371:Trpm3 UTSW 19 22902193 missense probably benign 0.27
R7467:Trpm3 UTSW 19 22978334 missense possibly damaging 0.82
R7488:Trpm3 UTSW 19 22978573 missense probably damaging 1.00
R7495:Trpm3 UTSW 19 22897796 missense probably benign 0.28
R7600:Trpm3 UTSW 19 22926094 missense possibly damaging 0.68
R7710:Trpm3 UTSW 19 22918790 missense probably damaging 0.97
R7877:Trpm3 UTSW 19 22904784 missense probably benign 0.25
R8184:Trpm3 UTSW 19 22918696 missense possibly damaging 0.46
R8234:Trpm3 UTSW 19 22715276 missense possibly damaging 0.47
R8236:Trpm3 UTSW 19 22987408 missense probably benign 0.00
R8443:Trpm3 UTSW 19 22698862 missense possibly damaging 0.90
Z1176:Trpm3 UTSW 19 22987490 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-04-24