Incidental Mutation 'R1620:Npas2'
ID174587
Institutional Source Beutler Lab
Gene Symbol Npas2
Ensembl Gene ENSMUSG00000026077
Gene Nameneuronal PAS domain protein 2
SynonymsbHLHe9, MOP4
MMRRC Submission 039657-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1620 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location39193731-39363236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39333912 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 415 (S415P)
Ref Sequence ENSEMBL: ENSMUSP00000054719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056815]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056815
AA Change: S415P

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054719
Gene: ENSMUSG00000026077
AA Change: S415P

DomainStartEndE-ValueType
HLH 15 65 6.56e-10 SMART
PAS 84 150 4.28e-10 SMART
PAS 239 305 4.03e-6 SMART
PAC 311 354 6.2e-7 SMART
low complexity region 400 419 N/A INTRINSIC
coiled coil region 510 538 N/A INTRINSIC
low complexity region 563 583 N/A INTRINSIC
low complexity region 623 643 N/A INTRINSIC
low complexity region 745 768 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Meta Mutation Damage Score 0.1985 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. The encoded protein may play a regulatory role in the acquisition of specific types of memory. It also may function as a part of a molecular clock operative in the mammalian forebrain. [provided by RefSeq, Dec 2014]
PHENOTYPE: Targeted mutation of this gene results in deficits in complex emotional long-term memory tasks [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2c2 T C 8: 119,749,126 V586A probably benign Het
Atp8a2 T A 14: 59,791,183 H945L probably benign Het
Bfar G T 16: 13,688,846 V187F probably damaging Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Capn2 A T 1: 182,517,137 I73N probably damaging Het
Cfc1 C A 1: 34,536,473 A76E possibly damaging Het
Chl1 T C 6: 103,690,242 F398L probably benign Het
Cyp2u1 A G 3: 131,302,701 S143P probably damaging Het
Dlgap4 T A 2: 156,749,136 Y57* probably null Het
Epha4 T A 1: 77,374,926 R897S probably benign Het
Fscn2 A T 11: 120,366,685 T291S probably damaging Het
Gga1 G A 15: 78,888,470 S267N probably damaging Het
Gigyf2 A G 1: 87,449,128 T1287A probably damaging Het
Gm10037 T C 13: 67,842,990 probably benign Het
Gm10845 C A 14: 79,863,229 noncoding transcript Het
Gm11559 T A 11: 99,865,056 L177Q unknown Het
Itga9 A G 9: 118,843,502 T195A probably benign Het
Lama1 A G 17: 67,767,033 T935A probably benign Het
Lrrk1 G T 7: 66,381,538 T4K probably benign Het
Lrrn1 G A 6: 107,568,366 C375Y probably damaging Het
Maip1 T C 1: 57,409,985 probably null Het
Mecom A T 3: 29,987,088 I119N probably damaging Het
Mrpl2 G A 17: 46,647,499 R69H probably benign Het
Muc16 A G 9: 18,510,477 V8246A possibly damaging Het
Myh3 C T 11: 67,088,736 probably benign Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Myot A T 18: 44,337,058 Q34L possibly damaging Het
Nlrp5 A G 7: 23,418,639 D596G probably damaging Het
Obox2 A G 7: 15,397,041 E66G probably benign Het
Olfr1312 G T 2: 112,042,246 T262K probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Phactr1 G T 13: 43,094,897 V356L probably damaging Het
Pparg A T 6: 115,473,281 I414L probably benign Het
Rapgef6 A T 11: 54,626,594 I371L possibly damaging Het
Rc3h1 T C 1: 160,954,973 V674A probably benign Het
Rps6ka4 T C 19: 6,838,149 Y159C probably damaging Het
Sf3b6 T C 12: 4,826,808 I67T possibly damaging Het
Spata17 T C 1: 187,183,215 probably benign Het
Ston1 A G 17: 88,635,816 T217A probably benign Het
Tank A G 2: 61,650,098 D326G possibly damaging Het
Tbc1d9 T A 8: 83,249,595 N594K probably damaging Het
Tfpi2 T A 6: 3,965,507 T102S probably benign Het
Ulk4 T G 9: 121,204,805 E589D possibly damaging Het
Usp40 A T 1: 87,994,225 H305Q probably damaging Het
Vmn1r170 A G 7: 23,606,329 K52R probably benign Het
Vmn1r194 A G 13: 22,244,963 D250G probably damaging Het
Wdr6 A T 9: 108,574,655 D676E possibly damaging Het
Xirp2 T A 2: 67,510,835 V1140E probably damaging Het
Other mutations in Npas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Npas2 APN 1 39333961 splice site probably benign
IGL02608:Npas2 APN 1 39345446 missense probably benign 0.06
IGL02882:Npas2 APN 1 39312996 missense probably benign 0.08
IGL02976:Npas2 APN 1 39287484 missense probably damaging 1.00
IGL03130:Npas2 APN 1 39313028 missense probably damaging 1.00
IGL03297:Npas2 APN 1 39292690 missense possibly damaging 0.71
R1263:Npas2 UTSW 1 39334768 missense possibly damaging 0.51
R1514:Npas2 UTSW 1 39311854 missense possibly damaging 0.82
R1618:Npas2 UTSW 1 39300727 missense probably damaging 1.00
R1844:Npas2 UTSW 1 39325375 missense probably damaging 1.00
R1868:Npas2 UTSW 1 39300678 missense probably benign 0.03
R1892:Npas2 UTSW 1 39345422 missense probably benign 0.00
R2002:Npas2 UTSW 1 39338195 missense probably benign 0.10
R3157:Npas2 UTSW 1 39347609 missense possibly damaging 0.92
R3551:Npas2 UTSW 1 39287562 missense probably benign 0.05
R4564:Npas2 UTSW 1 39287566 missense probably damaging 1.00
R4907:Npas2 UTSW 1 39361985 missense unknown
R5044:Npas2 UTSW 1 39347506 nonsense probably null
R5621:Npas2 UTSW 1 39359713 missense probably benign
R5779:Npas2 UTSW 1 39287571 missense possibly damaging 0.48
R5822:Npas2 UTSW 1 39347566 missense probably benign 0.00
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6155:Npas2 UTSW 1 39287476 missense probably damaging 1.00
R6193:Npas2 UTSW 1 39292762 missense probably damaging 1.00
R6220:Npas2 UTSW 1 39336061 missense probably benign 0.00
R6341:Npas2 UTSW 1 39300687 missense probably damaging 0.98
R6656:Npas2 UTSW 1 39361948 missense unknown
R6778:Npas2 UTSW 1 39325300 missense possibly damaging 0.92
R6803:Npas2 UTSW 1 39336049 missense probably benign 0.35
R7165:Npas2 UTSW 1 39292717 missense possibly damaging 0.79
R7250:Npas2 UTSW 1 39338107 missense probably damaging 1.00
R7268:Npas2 UTSW 1 39287577 missense probably damaging 0.98
R7284:Npas2 UTSW 1 39324467 missense probably benign 0.36
R7833:Npas2 UTSW 1 39326147 missense probably damaging 1.00
R7994:Npas2 UTSW 1 39328337 missense possibly damaging 0.86
R8013:Npas2 UTSW 1 39338065 missense probably benign
R8054:Npas2 UTSW 1 39287571 missense possibly damaging 0.69
R8510:Npas2 UTSW 1 39287472 missense probably damaging 1.00
Z1176:Npas2 UTSW 1 39336010 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGCCTCTTGGTGATGGTACAACAC -3'
(R):5'- CCCTGTGCATTCTGGGTAAAGGTG -3'

Sequencing Primer
(F):5'- CCTAAGATGATAGAGCATTTCTCCC -3'
(R):5'- TAAAGGTGGCCTGACCCAAC -3'
Posted On2014-04-24