Incidental Mutation 'R1620:Maip1'
ID 174588
Institutional Source Beutler Lab
Gene Symbol Maip1
Ensembl Gene ENSMUSG00000025971
Gene Name matrix AAA peptidase interacting protein 1
Synonyms 9430016H08Rik
MMRRC Submission 039657-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R1620 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 57445487-57457112 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 57449144 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027114] [ENSMUST00000079998] [ENSMUST00000160118] [ENSMUST00000160837] [ENSMUST00000162686]
AlphaFold Q8BHE8
Predicted Effect probably null
Transcript: ENSMUST00000027114
SMART Domains Protein: ENSMUSP00000027114
Gene: ENSMUSG00000025971

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Blast:Tim44 131 210 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000079998
SMART Domains Protein: ENSMUSP00000078912
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097732
Predicted Effect probably benign
Transcript: ENSMUST00000160118
SMART Domains Protein: ENSMUSP00000125386
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160837
SMART Domains Protein: ENSMUSP00000128576
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
JmjC 103 255 2.25e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161780
SMART Domains Protein: ENSMUSP00000125487
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185709
Predicted Effect probably benign
Transcript: ENSMUST00000162686
SMART Domains Protein: ENSMUSP00000125427
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
JmjC 105 265 5.8e-3 SMART
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2c2 T C 8: 120,475,865 (GRCm39) V586A probably benign Het
Atp8a2 T A 14: 60,028,632 (GRCm39) H945L probably benign Het
Bfar G T 16: 13,506,710 (GRCm39) V187F probably damaging Het
Capn2 A T 1: 182,344,702 (GRCm39) I73N probably damaging Het
Cfc1 C A 1: 34,575,554 (GRCm39) A76E possibly damaging Het
Chl1 T C 6: 103,667,203 (GRCm39) F398L probably benign Het
Cyp2u1 A G 3: 131,096,350 (GRCm39) S143P probably damaging Het
Dlgap4 T A 2: 156,591,056 (GRCm39) Y57* probably null Het
Epha4 T A 1: 77,351,563 (GRCm39) R897S probably benign Het
Fscn2 A T 11: 120,257,511 (GRCm39) T291S probably damaging Het
Gga1 G A 15: 78,772,670 (GRCm39) S267N probably damaging Het
Gigyf2 A G 1: 87,376,850 (GRCm39) T1287A probably damaging Het
Gm10845 C A 14: 80,100,669 (GRCm39) noncoding transcript Het
Gm11559 T A 11: 99,755,882 (GRCm39) L177Q unknown Het
Itga9 A G 9: 118,672,570 (GRCm39) T195A probably benign Het
Krbox5 T C 13: 67,991,109 (GRCm39) probably benign Het
Lama1 A G 17: 68,074,028 (GRCm39) T935A probably benign Het
Lrrk1 G T 7: 66,031,286 (GRCm39) T4K probably benign Het
Lrrn1 G A 6: 107,545,327 (GRCm39) C375Y probably damaging Het
Mecom A T 3: 30,041,237 (GRCm39) I119N probably damaging Het
Mrpl2 G A 17: 46,958,425 (GRCm39) R69H probably benign Het
Muc16 A G 9: 18,421,773 (GRCm39) V8246A possibly damaging Het
Myh3 C T 11: 66,979,562 (GRCm39) probably benign Het
Myocd A G 11: 65,087,220 (GRCm39) S236P probably benign Het
Myot A T 18: 44,470,125 (GRCm39) Q34L possibly damaging Het
Nlrp5 A G 7: 23,118,064 (GRCm39) D596G probably damaging Het
Npas2 T C 1: 39,372,993 (GRCm39) S415P possibly damaging Het
Obox2 A G 7: 15,130,966 (GRCm39) E66G probably benign Het
Or4f59 G T 2: 111,872,591 (GRCm39) T262K probably benign Het
Pcdh9 G A 14: 94,125,741 (GRCm39) P143L probably damaging Het
Phactr1 G T 13: 43,248,373 (GRCm39) V356L probably damaging Het
Pparg A T 6: 115,450,242 (GRCm39) I414L probably benign Het
Rapgef6 A T 11: 54,517,420 (GRCm39) I371L possibly damaging Het
Rc3h1 T C 1: 160,782,543 (GRCm39) V674A probably benign Het
Rps6ka4 T C 19: 6,815,517 (GRCm39) Y159C probably damaging Het
Sf3b6 T C 12: 4,876,808 (GRCm39) I67T possibly damaging Het
Sp140l2 A G 1: 85,231,907 (GRCm39) probably benign Het
Spata17 T C 1: 186,915,412 (GRCm39) probably benign Het
Ston1 A G 17: 88,943,244 (GRCm39) T217A probably benign Het
Tank A G 2: 61,480,442 (GRCm39) D326G possibly damaging Het
Tbc1d9 T A 8: 83,976,224 (GRCm39) N594K probably damaging Het
Tfpi2 T A 6: 3,965,507 (GRCm39) T102S probably benign Het
Ulk4 T G 9: 121,033,871 (GRCm39) E589D possibly damaging Het
Usp40 A T 1: 87,921,947 (GRCm39) H305Q probably damaging Het
Vmn1r170 A G 7: 23,305,754 (GRCm39) K52R probably benign Het
Vmn1r194 A G 13: 22,429,133 (GRCm39) D250G probably damaging Het
Wdr6 A T 9: 108,451,854 (GRCm39) D676E possibly damaging Het
Xirp2 T A 2: 67,341,179 (GRCm39) V1140E probably damaging Het
Other mutations in Maip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:Maip1 APN 1 57,449,114 (GRCm39) missense probably damaging 1.00
IGL03064:Maip1 APN 1 57,446,359 (GRCm39) missense probably damaging 1.00
R0403:Maip1 UTSW 1 57,446,355 (GRCm39) missense probably benign 0.14
R0411:Maip1 UTSW 1 57,454,852 (GRCm39) missense probably damaging 1.00
R0732:Maip1 UTSW 1 57,450,994 (GRCm39) missense probably damaging 1.00
R1569:Maip1 UTSW 1 57,452,554 (GRCm39) splice site probably benign
R2830:Maip1 UTSW 1 57,454,822 (GRCm39) missense possibly damaging 0.53
R4574:Maip1 UTSW 1 57,452,404 (GRCm39) missense possibly damaging 0.90
R4605:Maip1 UTSW 1 57,450,891 (GRCm39) missense probably benign 0.00
R5082:Maip1 UTSW 1 57,451,010 (GRCm39) critical splice donor site probably null
R5178:Maip1 UTSW 1 57,454,849 (GRCm39) missense probably benign 0.06
R5262:Maip1 UTSW 1 57,446,131 (GRCm39) missense probably damaging 0.96
R5883:Maip1 UTSW 1 57,446,260 (GRCm39) missense probably damaging 0.99
R6837:Maip1 UTSW 1 57,454,891 (GRCm39) makesense probably null
R7445:Maip1 UTSW 1 57,446,190 (GRCm39) missense possibly damaging 0.79
R7687:Maip1 UTSW 1 57,451,003 (GRCm39) missense probably damaging 0.98
R8408:Maip1 UTSW 1 57,449,102 (GRCm39) missense probably damaging 1.00
R8956:Maip1 UTSW 1 57,450,961 (GRCm39) missense probably damaging 1.00
R9093:Maip1 UTSW 1 57,446,311 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCAAGCCATCTGAGAAAAGGCAATC -3'
(R):5'- GCCTATCTATGCTGCTAAGTGCCC -3'

Sequencing Primer
(F):5'- GCTATCACGTTTACCATAAAGCAG -3'
(R):5'- GCTAAGTGCCCGGAGTTG -3'
Posted On 2014-04-24