Incidental Mutation 'R1620:Spata17'
ID174594
Institutional Source Beutler Lab
Gene Symbol Spata17
Ensembl Gene ENSMUSG00000026611
Gene Namespermatogenesis associated 17
Synonyms1700065F16Rik, 4930504I07Rik, 4930513F16Rik
MMRRC Submission 039657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1620 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location187044648-187215465 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 187183215 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027908] [ENSMUST00000110945] [ENSMUST00000183819] [ENSMUST00000183931]
Predicted Effect probably benign
Transcript: ENSMUST00000027908
SMART Domains Protein: ENSMUSP00000027908
Gene: ENSMUSG00000026611

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110945
SMART Domains Protein: ENSMUSP00000106570
Gene: ENSMUSG00000026611

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159848
SMART Domains Protein: ENSMUSP00000123771
Gene: ENSMUSG00000026611

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183819
SMART Domains Protein: ENSMUSP00000138855
Gene: ENSMUSG00000026611

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183931
SMART Domains Protein: ENSMUSP00000139329
Gene: ENSMUSG00000026611

DomainStartEndE-ValueType
low complexity region 39 63 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2c2 T C 8: 119,749,126 V586A probably benign Het
Atp8a2 T A 14: 59,791,183 H945L probably benign Het
Bfar G T 16: 13,688,846 V187F probably damaging Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Capn2 A T 1: 182,517,137 I73N probably damaging Het
Cfc1 C A 1: 34,536,473 A76E possibly damaging Het
Chl1 T C 6: 103,690,242 F398L probably benign Het
Cyp2u1 A G 3: 131,302,701 S143P probably damaging Het
Dlgap4 T A 2: 156,749,136 Y57* probably null Het
Epha4 T A 1: 77,374,926 R897S probably benign Het
Fscn2 A T 11: 120,366,685 T291S probably damaging Het
Gga1 G A 15: 78,888,470 S267N probably damaging Het
Gigyf2 A G 1: 87,449,128 T1287A probably damaging Het
Gm10037 T C 13: 67,842,990 probably benign Het
Gm10845 C A 14: 79,863,229 noncoding transcript Het
Gm11559 T A 11: 99,865,056 L177Q unknown Het
Itga9 A G 9: 118,843,502 T195A probably benign Het
Lama1 A G 17: 67,767,033 T935A probably benign Het
Lrrk1 G T 7: 66,381,538 T4K probably benign Het
Lrrn1 G A 6: 107,568,366 C375Y probably damaging Het
Maip1 T C 1: 57,409,985 probably null Het
Mecom A T 3: 29,987,088 I119N probably damaging Het
Mrpl2 G A 17: 46,647,499 R69H probably benign Het
Muc16 A G 9: 18,510,477 V8246A possibly damaging Het
Myh3 C T 11: 67,088,736 probably benign Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Myot A T 18: 44,337,058 Q34L possibly damaging Het
Nlrp5 A G 7: 23,418,639 D596G probably damaging Het
Npas2 T C 1: 39,333,912 S415P possibly damaging Het
Obox2 A G 7: 15,397,041 E66G probably benign Het
Olfr1312 G T 2: 112,042,246 T262K probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Phactr1 G T 13: 43,094,897 V356L probably damaging Het
Pparg A T 6: 115,473,281 I414L probably benign Het
Rapgef6 A T 11: 54,626,594 I371L possibly damaging Het
Rc3h1 T C 1: 160,954,973 V674A probably benign Het
Rps6ka4 T C 19: 6,838,149 Y159C probably damaging Het
Sf3b6 T C 12: 4,826,808 I67T possibly damaging Het
Ston1 A G 17: 88,635,816 T217A probably benign Het
Tank A G 2: 61,650,098 D326G possibly damaging Het
Tbc1d9 T A 8: 83,249,595 N594K probably damaging Het
Tfpi2 T A 6: 3,965,507 T102S probably benign Het
Ulk4 T G 9: 121,204,805 E589D possibly damaging Het
Usp40 A T 1: 87,994,225 H305Q probably damaging Het
Vmn1r170 A G 7: 23,606,329 K52R probably benign Het
Vmn1r194 A G 13: 22,244,963 D250G probably damaging Het
Wdr6 A T 9: 108,574,655 D676E possibly damaging Het
Xirp2 T A 2: 67,510,835 V1140E probably damaging Het
Other mutations in Spata17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Spata17 APN 1 187117339 missense probably benign 0.34
IGL02101:Spata17 APN 1 187117460 missense probably benign 0.40
IGL02268:Spata17 APN 1 187140398 missense probably damaging 0.97
IGL02406:Spata17 APN 1 187117261 critical splice donor site probably null
IGL02429:Spata17 APN 1 187140434 missense possibly damaging 0.66
IGL03333:Spata17 APN 1 187140470 start codon destroyed probably null
R0147:Spata17 UTSW 1 187112601 missense probably damaging 1.00
R0148:Spata17 UTSW 1 187112601 missense probably damaging 1.00
R0269:Spata17 UTSW 1 187097872 missense probably benign 0.02
R1521:Spata17 UTSW 1 187193994 missense probably damaging 0.96
R2017:Spata17 UTSW 1 187048453 missense possibly damaging 0.73
R2113:Spata17 UTSW 1 187097911 missense possibly damaging 0.93
R2251:Spata17 UTSW 1 187048473 missense possibly damaging 0.96
R4260:Spata17 UTSW 1 187048480 missense possibly damaging 0.53
R4572:Spata17 UTSW 1 187193996 missense possibly damaging 0.91
R4894:Spata17 UTSW 1 187140446 missense probably benign 0.00
R4910:Spata17 UTSW 1 187194011 missense probably damaging 0.98
R6277:Spata17 UTSW 1 187193954 nonsense probably null
R7200:Spata17 UTSW 1 187112503 missense probably benign 0.00
R7735:Spata17 UTSW 1 187140380 missense unknown
V7732:Spata17 UTSW 1 187048480 missense possibly damaging 0.53
X0027:Spata17 UTSW 1 187193959 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGGGCTTGGCACAGCTAACTTTC -3'
(R):5'- GCAAGGCACAATTTTGCCTCATCAC -3'

Sequencing Primer
(F):5'- GGCACAGCTAACTTTCTAACTAGTG -3'
(R):5'- ACTCAGCGGAGAGCATTTTATG -3'
Posted On2014-04-24