Incidental Mutation 'R1620:Dlgap4'
ID174599
Institutional Source Beutler Lab
Gene Symbol Dlgap4
Ensembl Gene ENSMUSG00000061689
Gene NameDLG associated protein 4
SynonymsSAP90/PSD-95-associated protein 4, WBP16, PSD-95/SAP90 binding protein 4, Sapap4, DAP4
MMRRC Submission 039657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1620 (G1)
Quality Score140
Status Validated
Chromosome2
Chromosomal Location156613705-156764363 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 156749136 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 57 (Y57*)
Ref Sequence ENSEMBL: ENSMUSP00000135409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000094] [ENSMUST00000070782] [ENSMUST00000099145] [ENSMUST00000109566] [ENSMUST00000109567] [ENSMUST00000109568] [ENSMUST00000131157] [ENSMUST00000137356] [ENSMUST00000146412] [ENSMUST00000169464] [ENSMUST00000171030] [ENSMUST00000177013]
Predicted Effect probably null
Transcript: ENSMUST00000000094
AA Change: Y70*
SMART Domains Protein: ENSMUSP00000000094
Gene: ENSMUSG00000061689
AA Change: Y70*

DomainStartEndE-ValueType
Pfam:GKAP 3 232 2.4e-81 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000070782
AA Change: Y761*
SMART Domains Protein: ENSMUSP00000068745
Gene: ENSMUSG00000061689
AA Change: Y761*

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
Pfam:GKAP 638 989 1.2e-132 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099145
AA Change: Y225*
SMART Domains Protein: ENSMUSP00000096749
Gene: ENSMUSG00000061689
AA Change: Y225*

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
low complexity region 61 81 N/A INTRINSIC
low complexity region 89 98 N/A INTRINSIC
Pfam:GKAP 114 453 2.4e-126 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109566
AA Change: Y57*
SMART Domains Protein: ENSMUSP00000105194
Gene: ENSMUSG00000061689
AA Change: Y57*

DomainStartEndE-ValueType
Pfam:GKAP 1 285 2e-114 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109567
AA Change: Y761*
SMART Domains Protein: ENSMUSP00000105195
Gene: ENSMUSG00000061689
AA Change: Y761*

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
Pfam:GKAP 636 989 4.4e-116 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109568
AA Change: Y747*
SMART Domains Protein: ENSMUSP00000105196
Gene: ENSMUSG00000061689
AA Change: Y747*

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 463 480 N/A INTRINSIC
low complexity region 510 537 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 583 603 N/A INTRINSIC
low complexity region 611 620 N/A INTRINSIC
Pfam:GKAP 636 975 5.6e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127944
Predicted Effect probably benign
Transcript: ENSMUST00000131157
SMART Domains Protein: ENSMUSP00000134941
Gene: ENSMUSG00000061689

DomainStartEndE-ValueType
Pfam:GKAP 1 110 2.2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137356
Predicted Effect probably null
Transcript: ENSMUST00000146412
AA Change: Y57*
SMART Domains Protein: ENSMUSP00000135156
Gene: ENSMUSG00000061689
AA Change: Y57*

DomainStartEndE-ValueType
Pfam:GKAP 1 122 3.4e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169464
AA Change: Y764*
SMART Domains Protein: ENSMUSP00000126980
Gene: ENSMUSG00000061689
AA Change: Y764*

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
Pfam:GKAP 660 992 1.5e-148 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171030
AA Change: Y57*
SMART Domains Protein: ENSMUSP00000129756
Gene: ENSMUSG00000061689
AA Change: Y57*

DomainStartEndE-ValueType
Pfam:GKAP 1 266 8.7e-103 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177013
AA Change: Y57*
SMART Domains Protein: ENSMUSP00000135409
Gene: ENSMUSG00000061689
AA Change: Y57*

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: This gene encodes a membrane-associated guanylate kinase found at the postsynaptic density in neuronal cells. The encoded protein may play a role in synapse organization and neuronal signalling. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2c2 T C 8: 119,749,126 V586A probably benign Het
Atp8a2 T A 14: 59,791,183 H945L probably benign Het
Bfar G T 16: 13,688,846 V187F probably damaging Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Capn2 A T 1: 182,517,137 I73N probably damaging Het
Cfc1 C A 1: 34,536,473 A76E possibly damaging Het
Chl1 T C 6: 103,690,242 F398L probably benign Het
Cyp2u1 A G 3: 131,302,701 S143P probably damaging Het
Epha4 T A 1: 77,374,926 R897S probably benign Het
Fscn2 A T 11: 120,366,685 T291S probably damaging Het
Gga1 G A 15: 78,888,470 S267N probably damaging Het
Gigyf2 A G 1: 87,449,128 T1287A probably damaging Het
Gm10037 T C 13: 67,842,990 probably benign Het
Gm10845 C A 14: 79,863,229 noncoding transcript Het
Gm11559 T A 11: 99,865,056 L177Q unknown Het
Itga9 A G 9: 118,843,502 T195A probably benign Het
Lama1 A G 17: 67,767,033 T935A probably benign Het
Lrrk1 G T 7: 66,381,538 T4K probably benign Het
Lrrn1 G A 6: 107,568,366 C375Y probably damaging Het
Maip1 T C 1: 57,409,985 probably null Het
Mecom A T 3: 29,987,088 I119N probably damaging Het
Mrpl2 G A 17: 46,647,499 R69H probably benign Het
Muc16 A G 9: 18,510,477 V8246A possibly damaging Het
Myh3 C T 11: 67,088,736 probably benign Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Myot A T 18: 44,337,058 Q34L possibly damaging Het
Nlrp5 A G 7: 23,418,639 D596G probably damaging Het
Npas2 T C 1: 39,333,912 S415P possibly damaging Het
Obox2 A G 7: 15,397,041 E66G probably benign Het
Olfr1312 G T 2: 112,042,246 T262K probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Phactr1 G T 13: 43,094,897 V356L probably damaging Het
Pparg A T 6: 115,473,281 I414L probably benign Het
Rapgef6 A T 11: 54,626,594 I371L possibly damaging Het
Rc3h1 T C 1: 160,954,973 V674A probably benign Het
Rps6ka4 T C 19: 6,838,149 Y159C probably damaging Het
Sf3b6 T C 12: 4,826,808 I67T possibly damaging Het
Spata17 T C 1: 187,183,215 probably benign Het
Ston1 A G 17: 88,635,816 T217A probably benign Het
Tank A G 2: 61,650,098 D326G possibly damaging Het
Tbc1d9 T A 8: 83,249,595 N594K probably damaging Het
Tfpi2 T A 6: 3,965,507 T102S probably benign Het
Ulk4 T G 9: 121,204,805 E589D possibly damaging Het
Usp40 A T 1: 87,994,225 H305Q probably damaging Het
Vmn1r170 A G 7: 23,606,329 K52R probably benign Het
Vmn1r194 A G 13: 22,244,963 D250G probably damaging Het
Wdr6 A T 9: 108,574,655 D676E possibly damaging Het
Xirp2 T A 2: 67,510,835 V1140E probably damaging Het
Other mutations in Dlgap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:Dlgap4 APN 2 156711139 missense probably damaging 1.00
IGL02732:Dlgap4 APN 2 156749323 missense probably benign 0.30
IGL02868:Dlgap4 APN 2 156700896 missense probably damaging 1.00
IGL03169:Dlgap4 APN 2 156711018 splice site probably null
IGL03220:Dlgap4 APN 2 156704626 missense probably damaging 1.00
E0374:Dlgap4 UTSW 2 156761843 missense probably damaging 1.00
R0413:Dlgap4 UTSW 2 156762826 missense probably damaging 1.00
R0573:Dlgap4 UTSW 2 156746191 missense probably benign 0.32
R0645:Dlgap4 UTSW 2 156761879 missense probably damaging 1.00
R0893:Dlgap4 UTSW 2 156745978 nonsense probably null
R1472:Dlgap4 UTSW 2 156760901 nonsense probably null
R1636:Dlgap4 UTSW 2 156746077 nonsense probably null
R2078:Dlgap4 UTSW 2 156762826 missense probably damaging 1.00
R2173:Dlgap4 UTSW 2 156762812 missense probably damaging 1.00
R2264:Dlgap4 UTSW 2 156701463 missense probably benign 0.00
R2348:Dlgap4 UTSW 2 156701206 missense possibly damaging 0.80
R3608:Dlgap4 UTSW 2 156748412 intron probably benign
R3872:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3873:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3874:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3897:Dlgap4 UTSW 2 156746069 missense probably damaging 1.00
R5068:Dlgap4 UTSW 2 156707111 missense probably benign
R5286:Dlgap4 UTSW 2 156745919 missense probably damaging 1.00
R5302:Dlgap4 UTSW 2 156760898 missense probably damaging 1.00
R5568:Dlgap4 UTSW 2 156762901 makesense probably null
R5691:Dlgap4 UTSW 2 156704470 missense probably benign
R5741:Dlgap4 UTSW 2 156711048 missense probably damaging 1.00
R5917:Dlgap4 UTSW 2 156704540 missense probably damaging 1.00
R6140:Dlgap4 UTSW 2 156762729 unclassified probably null
R6992:Dlgap4 UTSW 2 156748940 splice site probably null
R7082:Dlgap4 UTSW 2 156748422 critical splice donor site probably null
R7566:Dlgap4 UTSW 2 156762737 missense probably benign 0.00
R7698:Dlgap4 UTSW 2 156749095 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGATACCCAGGATGCCAACGAC -3'
(R):5'- TGAACACTGAGAGGCAAGCTCAC -3'

Sequencing Primer
(F):5'- GACTCCAGTTGTAAGTCATCTGAGAG -3'
(R):5'- GTAAGAACAGGGCCTATGATCCTC -3'
Posted On2014-04-24