Incidental Mutation 'R1620:Nlrp5'
ID174608
Institutional Source Beutler Lab
Gene Symbol Nlrp5
Ensembl Gene ENSMUSG00000015721
Gene NameNLR family, pyrin domain containing 5
SynonymsMater, Nalp5, Op1
MMRRC Submission 039657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R1620 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23385889-23441922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23418639 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 596 (D596G)
Ref Sequence ENSEMBL: ENSMUSP00000122007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015866] [ENSMUST00000086341] [ENSMUST00000108441] [ENSMUST00000133237] [ENSMUST00000139661]
Predicted Effect probably damaging
Transcript: ENSMUST00000015866
AA Change: D596G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015866
Gene: ENSMUSG00000015721
AA Change: D596G

DomainStartEndE-ValueType
Pfam:NACHT 191 359 3.5e-45 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1031 6.04e1 SMART
LRR 1032 1059 1.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086341
AA Change: D580G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083524
Gene: ENSMUSG00000015721
AA Change: D580G

DomainStartEndE-ValueType
Pfam:NACHT 175 343 1.5e-44 PFAM
LRR 675 702 4.51e1 SMART
LRR 731 758 1.36e-2 SMART
LRR 760 787 6.79e0 SMART
LRR 788 815 4.3e0 SMART
LRR 817 844 1.42e0 SMART
LRR 845 872 1.2e-3 SMART
LRR 874 901 1.2e2 SMART
LRR 902 929 2.2e-2 SMART
LRR 931 958 1.56e2 SMART
LRR 959 986 3.36e-7 SMART
LRR 988 1015 6.04e1 SMART
LRR 1016 1043 1.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108441
AA Change: D596G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104080
Gene: ENSMUSG00000015721
AA Change: D596G

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.5e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1033 1.28e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133237
AA Change: D596G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122007
Gene: ENSMUSG00000015721
AA Change: D596G

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.3e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139661
AA Change: D596G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118638
Gene: ENSMUSG00000015721
AA Change: D596G

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.6e-44 PFAM
Blast:LRR 691 718 8e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207536
Meta Mutation Damage Score 0.2638 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: This gene encodes a member of the NACHT, leucine-rich repeat, and pyrin domain containing family. Members of this family have a pyrin domain at the N-terminus, a central NACHT domain, and a C-terminal leucine-rich repeat domain. This gene encodes a maternal-effect factor that is essential for early embryonic development in the mouse. Homozygous null mutant females are sterile, and embryos die following the first cleavage. This gene is required for endoplasmic reticulum redistribution and calcium homeostasis in oocytes. In addition, ovulated oocytes mutant for this gene have abnormal mitochondrial localization and increased mitochondrial activity, which results in mitochondrial damage and early embryonic lethality. Pseudogenes of this gene have been found on chromosomes 7 and 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Females lacking this maternal effect gene are sterile. Preimplantation embryos do not develop past the 2-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2c2 T C 8: 119,749,126 V586A probably benign Het
Atp8a2 T A 14: 59,791,183 H945L probably benign Het
Bfar G T 16: 13,688,846 V187F probably damaging Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Capn2 A T 1: 182,517,137 I73N probably damaging Het
Cfc1 C A 1: 34,536,473 A76E possibly damaging Het
Chl1 T C 6: 103,690,242 F398L probably benign Het
Cyp2u1 A G 3: 131,302,701 S143P probably damaging Het
Dlgap4 T A 2: 156,749,136 Y57* probably null Het
Epha4 T A 1: 77,374,926 R897S probably benign Het
Fscn2 A T 11: 120,366,685 T291S probably damaging Het
Gga1 G A 15: 78,888,470 S267N probably damaging Het
Gigyf2 A G 1: 87,449,128 T1287A probably damaging Het
Gm10037 T C 13: 67,842,990 probably benign Het
Gm10845 C A 14: 79,863,229 noncoding transcript Het
Gm11559 T A 11: 99,865,056 L177Q unknown Het
Itga9 A G 9: 118,843,502 T195A probably benign Het
Lama1 A G 17: 67,767,033 T935A probably benign Het
Lrrk1 G T 7: 66,381,538 T4K probably benign Het
Lrrn1 G A 6: 107,568,366 C375Y probably damaging Het
Maip1 T C 1: 57,409,985 probably null Het
Mecom A T 3: 29,987,088 I119N probably damaging Het
Mrpl2 G A 17: 46,647,499 R69H probably benign Het
Muc16 A G 9: 18,510,477 V8246A possibly damaging Het
Myh3 C T 11: 67,088,736 probably benign Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Myot A T 18: 44,337,058 Q34L possibly damaging Het
Npas2 T C 1: 39,333,912 S415P possibly damaging Het
Obox2 A G 7: 15,397,041 E66G probably benign Het
Olfr1312 G T 2: 112,042,246 T262K probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Phactr1 G T 13: 43,094,897 V356L probably damaging Het
Pparg A T 6: 115,473,281 I414L probably benign Het
Rapgef6 A T 11: 54,626,594 I371L possibly damaging Het
Rc3h1 T C 1: 160,954,973 V674A probably benign Het
Rps6ka4 T C 19: 6,838,149 Y159C probably damaging Het
Sf3b6 T C 12: 4,826,808 I67T possibly damaging Het
Spata17 T C 1: 187,183,215 probably benign Het
Ston1 A G 17: 88,635,816 T217A probably benign Het
Tank A G 2: 61,650,098 D326G possibly damaging Het
Tbc1d9 T A 8: 83,249,595 N594K probably damaging Het
Tfpi2 T A 6: 3,965,507 T102S probably benign Het
Ulk4 T G 9: 121,204,805 E589D possibly damaging Het
Usp40 A T 1: 87,994,225 H305Q probably damaging Het
Vmn1r170 A G 7: 23,606,329 K52R probably benign Het
Vmn1r194 A G 13: 22,244,963 D250G probably damaging Het
Wdr6 A T 9: 108,574,655 D676E possibly damaging Het
Xirp2 T A 2: 67,510,835 V1140E probably damaging Het
Other mutations in Nlrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Nlrp5 APN 7 23441788 missense probably damaging 1.00
IGL01393:Nlrp5 APN 7 23404174 missense probably null 0.04
IGL01505:Nlrp5 APN 7 23417734 missense probably benign 0.15
IGL02010:Nlrp5 APN 7 23417372 missense probably benign 0.04
IGL02223:Nlrp5 APN 7 23430022 splice site probably benign
IGL02341:Nlrp5 APN 7 23404152 missense probably benign 0.43
IGL02532:Nlrp5 APN 7 23409973 missense possibly damaging 0.70
IGL02619:Nlrp5 APN 7 23424064 critical splice donor site probably null
IGL02659:Nlrp5 APN 7 23418581 missense probably damaging 1.00
IGL02828:Nlrp5 APN 7 23421460 missense possibly damaging 0.81
IGL03018:Nlrp5 APN 7 23417747 missense probably benign 0.06
IGL03164:Nlrp5 APN 7 23418373 nonsense probably null
IGL03397:Nlrp5 APN 7 23413334 missense probably damaging 1.00
IGL03404:Nlrp5 APN 7 23430034 missense probably benign 0.00
R0310:Nlrp5 UTSW 7 23430157 missense probably damaging 0.99
R0549:Nlrp5 UTSW 7 23441802 missense probably damaging 1.00
R0573:Nlrp5 UTSW 7 23417631 missense probably damaging 1.00
R0647:Nlrp5 UTSW 7 23417707 missense probably damaging 1.00
R0675:Nlrp5 UTSW 7 23417417 missense possibly damaging 0.53
R0826:Nlrp5 UTSW 7 23417708 missense probably benign 0.13
R1511:Nlrp5 UTSW 7 23413347 missense probably damaging 0.99
R1858:Nlrp5 UTSW 7 23418161 missense probably damaging 0.98
R1867:Nlrp5 UTSW 7 23423982 missense possibly damaging 0.85
R1887:Nlrp5 UTSW 7 23417484 missense probably damaging 1.00
R1899:Nlrp5 UTSW 7 23404797 missense probably benign 0.00
R1901:Nlrp5 UTSW 7 23423910 missense possibly damaging 0.94
R2032:Nlrp5 UTSW 7 23421512 missense probably damaging 1.00
R3083:Nlrp5 UTSW 7 23430163 missense probably benign 0.03
R3806:Nlrp5 UTSW 7 23404846 missense probably benign
R3907:Nlrp5 UTSW 7 23433646 missense possibly damaging 0.48
R4085:Nlrp5 UTSW 7 23430098 missense probably damaging 0.97
R4135:Nlrp5 UTSW 7 23418398 missense possibly damaging 0.92
R4609:Nlrp5 UTSW 7 23417748 missense probably benign 0.01
R4649:Nlrp5 UTSW 7 23418178 missense probably damaging 1.00
R4780:Nlrp5 UTSW 7 23435778 missense probably damaging 1.00
R4793:Nlrp5 UTSW 7 23417630 missense probably damaging 0.97
R5062:Nlrp5 UTSW 7 23435910 nonsense probably null
R5224:Nlrp5 UTSW 7 23417976 missense probably damaging 1.00
R5364:Nlrp5 UTSW 7 23418328 nonsense probably null
R5426:Nlrp5 UTSW 7 23418201 missense probably damaging 1.00
R5488:Nlrp5 UTSW 7 23417934 missense probably benign 0.03
R5762:Nlrp5 UTSW 7 23418839 missense possibly damaging 0.89
R6014:Nlrp5 UTSW 7 23409947 missense probably benign 0.02
R6130:Nlrp5 UTSW 7 23404173 missense probably benign 0.00
R6277:Nlrp5 UTSW 7 23421455 missense probably damaging 1.00
R6509:Nlrp5 UTSW 7 23417916 missense probably damaging 1.00
R6519:Nlrp5 UTSW 7 23417918 missense probably benign 0.22
R7042:Nlrp5 UTSW 7 23417480 missense possibly damaging 0.52
R7253:Nlrp5 UTSW 7 23417391 missense possibly damaging 0.93
R7336:Nlrp5 UTSW 7 23417634 missense probably damaging 0.98
R7371:Nlrp5 UTSW 7 23418423 missense probably damaging 0.99
R7449:Nlrp5 UTSW 7 23417526 missense probably benign 0.00
R7505:Nlrp5 UTSW 7 23407500 missense probably benign 0.01
R7580:Nlrp5 UTSW 7 23433749 missense probably damaging 1.00
R7588:Nlrp5 UTSW 7 23408151 missense probably benign 0.21
R7793:Nlrp5 UTSW 7 23423918 missense possibly damaging 0.87
R7795:Nlrp5 UTSW 7 23418794 missense possibly damaging 0.78
R7893:Nlrp5 UTSW 7 23418165 missense probably benign 0.12
R7976:Nlrp5 UTSW 7 23418165 missense probably benign 0.12
RF007:Nlrp5 UTSW 7 23418161 missense probably benign 0.16
U24488:Nlrp5 UTSW 7 23418228 missense possibly damaging 0.94
X0026:Nlrp5 UTSW 7 23417498 nonsense probably null
X0062:Nlrp5 UTSW 7 23417990 nonsense probably null
Z1088:Nlrp5 UTSW 7 23404167 missense possibly damaging 0.82
Z1088:Nlrp5 UTSW 7 23417586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGAGAACTGACGACACTCGCC -3'
(R):5'- CAAACTGGACTCAGGTCAAGTCCC -3'

Sequencing Primer
(F):5'- CTCCTCGGGATGAAGCG -3'
(R):5'- GTCCCATTAGTAAGCGAGTCATC -3'
Posted On2014-04-24