Mutagenetix > Incidental Mutations

Incidental Mutation 'R1620:Lrrk1'

174612

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

039657-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1620 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 66381538 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 4 (T4K)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277] [ENSMUST00000107486]

Predicted Effect

probably benign
Transcript: ENSMUST00000015277
AA Change: T4K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: T4K

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107486

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154893

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184685

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

95% (58/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp2c2	T	C	8: 119,749,126	V586A	probably benign	Het
Atp8a2	T	A	14: 59,791,183	H945L	probably benign	Het
Bfar	G	T	16: 13,688,846	V187F	probably damaging	Het
C130026I21Rik	A	G	1: 85,254,186		probably benign	Het
Capn2	A	T	1: 182,517,137	I73N	probably damaging	Het
Cfc1	C	A	1: 34,536,473	A76E	possibly damaging	Het
Chl1	T	C	6: 103,690,242	F398L	probably benign	Het
Cyp2u1	A	G	3: 131,302,701	S143P	probably damaging	Het
Dlgap4	T	A	2: 156,749,136	Y57*	probably null	Het
Epha4	T	A	1: 77,374,926	R897S	probably benign	Het
Fscn2	A	T	11: 120,366,685	T291S	probably damaging	Het
Gga1	G	A	15: 78,888,470	S267N	probably damaging	Het
Gigyf2	A	G	1: 87,449,128	T1287A	probably damaging	Het
Gm10037	T	C	13: 67,842,990		probably benign	Het
Gm10845	C	A	14: 79,863,229		noncoding transcript	Het
Gm11559	T	A	11: 99,865,056	L177Q	unknown	Het
Itga9	A	G	9: 118,843,502	T195A	probably benign	Het
Lama1	A	G	17: 67,767,033	T935A	probably benign	Het
Lrrn1	G	A	6: 107,568,366	C375Y	probably damaging	Het
Maip1	T	C	1: 57,409,985		probably null	Het
Mecom	A	T	3: 29,987,088	I119N	probably damaging	Het
Mrpl2	G	A	17: 46,647,499	R69H	probably benign	Het
Muc16	A	G	9: 18,510,477	V8246A	possibly damaging	Het
Myh3	C	T	11: 67,088,736		probably benign	Het
Myocd	A	G	11: 65,196,394	S236P	probably damaging	Het
Myot	A	T	18: 44,337,058	Q34L	possibly damaging	Het
Nlrp5	A	G	7: 23,418,639	D596G	probably damaging	Het
Npas2	T	C	1: 39,333,912	S415P	possibly damaging	Het
Obox2	A	G	7: 15,397,041	E66G	probably benign	Het
Olfr1312	G	T	2: 112,042,246	T262K	probably benign	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Phactr1	G	T	13: 43,094,897	V356L	probably damaging	Het
Pparg	A	T	6: 115,473,281	I414L	probably benign	Het
Rapgef6	A	T	11: 54,626,594	I371L	possibly damaging	Het
Rc3h1	T	C	1: 160,954,973	V674A	probably benign	Het
Rps6ka4	T	C	19: 6,838,149	Y159C	probably damaging	Het
Sf3b6	T	C	12: 4,826,808	I67T	possibly damaging	Het
Spata17	T	C	1: 187,183,215		probably benign	Het
Ston1	A	G	17: 88,635,816	T217A	probably benign	Het
Tank	A	G	2: 61,650,098	D326G	possibly damaging	Het
Tbc1d9	T	A	8: 83,249,595	N594K	probably damaging	Het
Tfpi2	T	A	6: 3,965,507	T102S	probably benign	Het
Ulk4	T	G	9: 121,204,805	E589D	possibly damaging	Het
Usp40	A	T	1: 87,994,225	H305Q	probably damaging	Het
Vmn1r170	A	G	7: 23,606,329	K52R	probably benign	Het
Vmn1r194	A	G	13: 22,244,963	D250G	probably damaging	Het
Wdr6	A	T	9: 108,574,655	D676E	possibly damaging	Het
Xirp2	T	A	2: 67,510,835	V1140E	probably damaging	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCCTGTAAAGCCACTGCCTGTAAG -3'
(R):5'- GATGTCTTTCTCCACCAGGATGAGC -3'

Sequencing Primer
(F):5'- ACTGCCTGTAAGTGCTGC -3'
(R):5'- ACCAGGATGAGCGTGTGTC -3'

Posted On

2014-04-24