Mutagenetix > Incidental Mutation

Incidental Mutation 'R1620:Rapgef6'

174621

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

MMRRC Submission

039657-MU

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1620 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 54626594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 371 (I371L)

Ref Sequence

ENSEMBL: ENSMUSP00000147135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000108895] [ENSMUST00000207429] [ENSMUST00000218995]

AlphaFold

Q5NCJ1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094536
AA Change: I86L

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: I86L

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	853	3.88e-84	SMART
low complexity region	944	957	N/A	INTRINSIC
low complexity region	972	989	N/A	INTRINSIC
low complexity region	1016	1061	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101206
AA Change: I371L

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: I371L

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102743
AA Change: I371L

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: I371L

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108894
AA Change: I86L

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: I86L

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	810	5.35e-87	SMART
low complexity region	952	965	N/A	INTRINSIC
low complexity region	980	997	N/A	INTRINSIC
low complexity region	1024	1069	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108895
AA Change: I371L

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533
AA Change: I371L

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.95e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	526	1.03e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149372

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207429
AA Change: I371L

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000218995
AA Change: I224L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220269

Meta Mutation Damage Score

0.2628

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

95% (58/61)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp2c2	T	C	8: 119,749,126	V586A	probably benign	Het
Atp8a2	T	A	14: 59,791,183	H945L	probably benign	Het
Bfar	G	T	16: 13,688,846	V187F	probably damaging	Het
C130026I21Rik	A	G	1: 85,254,186		probably benign	Het
Capn2	A	T	1: 182,517,137	I73N	probably damaging	Het
Cfc1	C	A	1: 34,536,473	A76E	possibly damaging	Het
Chl1	T	C	6: 103,690,242	F398L	probably benign	Het
Cyp2u1	A	G	3: 131,302,701	S143P	probably damaging	Het
Dlgap4	T	A	2: 156,749,136	Y57*	probably null	Het
Epha4	T	A	1: 77,374,926	R897S	probably benign	Het
Fscn2	A	T	11: 120,366,685	T291S	probably damaging	Het
Gga1	G	A	15: 78,888,470	S267N	probably damaging	Het
Gigyf2	A	G	1: 87,449,128	T1287A	probably damaging	Het
Gm10037	T	C	13: 67,842,990		probably benign	Het
Gm10845	C	A	14: 79,863,229		noncoding transcript	Het
Gm11559	T	A	11: 99,865,056	L177Q	unknown	Het
Itga9	A	G	9: 118,843,502	T195A	probably benign	Het
Lama1	A	G	17: 67,767,033	T935A	probably benign	Het
Lrrk1	G	T	7: 66,381,538	T4K	probably benign	Het
Lrrn1	G	A	6: 107,568,366	C375Y	probably damaging	Het
Maip1	T	C	1: 57,409,985		probably null	Het
Mecom	A	T	3: 29,987,088	I119N	probably damaging	Het
Mrpl2	G	A	17: 46,647,499	R69H	probably benign	Het
Muc16	A	G	9: 18,510,477	V8246A	possibly damaging	Het
Myh3	C	T	11: 67,088,736		probably benign	Het
Myocd	A	G	11: 65,196,394	S236P	probably benign	Het
Myot	A	T	18: 44,337,058	Q34L	possibly damaging	Het
Nlrp5	A	G	7: 23,418,639	D596G	probably damaging	Het
Npas2	T	C	1: 39,333,912	S415P	possibly damaging	Het
Obox2	A	G	7: 15,397,041	E66G	probably benign	Het
Olfr1312	G	T	2: 112,042,246	T262K	probably benign	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Phactr1	G	T	13: 43,094,897	V356L	probably damaging	Het
Pparg	A	T	6: 115,473,281	I414L	probably benign	Het
Rc3h1	T	C	1: 160,954,973	V674A	probably benign	Het
Rps6ka4	T	C	19: 6,838,149	Y159C	probably damaging	Het
Sf3b6	T	C	12: 4,826,808	I67T	possibly damaging	Het
Spata17	T	C	1: 187,183,215		probably benign	Het
Ston1	A	G	17: 88,635,816	T217A	probably benign	Het
Tank	A	G	2: 61,650,098	D326G	possibly damaging	Het
Tbc1d9	T	A	8: 83,249,595	N594K	probably damaging	Het
Tfpi2	T	A	6: 3,965,507	T102S	probably benign	Het
Ulk4	T	G	9: 121,204,805	E589D	possibly damaging	Het
Usp40	A	T	1: 87,994,225	H305Q	probably damaging	Het
Vmn1r170	A	G	7: 23,606,329	K52R	probably benign	Het
Vmn1r194	A	G	13: 22,244,963	D250G	probably damaging	Het
Wdr6	A	T	9: 108,574,655	D676E	possibly damaging	Het
Xirp2	T	A	2: 67,510,835	V1140E	probably damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null
R8917:Rapgef6	UTSW	11	54691566	nonsense	probably null
R8921:Rapgef6	UTSW	11	54679239	missense	probably benign	0.09
R9031:Rapgef6	UTSW	11	54687841	missense	probably benign	0.00
R9093:Rapgef6	UTSW	11	54597086	nonsense	probably null
R9354:Rapgef6	UTSW	11	54619923	missense	possibly damaging	0.66
R9514:Rapgef6	UTSW	11	54552858	missense	probably benign	0.14
R9516:Rapgef6	UTSW	11	54691343	missense	probably damaging	1.00
R9739:Rapgef6	UTSW	11	54622363	missense	probably benign	0.03
R9789:Rapgef6	UTSW	11	54649271	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ATGGCGGAGCTGCTTTTCTCTC -3'
(R):5'- ACACCCACCTTGATTACAATGTGTCC -3'

Sequencing Primer
(F):5'- AGAAGATTCCACTTTGGTCTCTG -3'
(R):5'- GATTACAATGTGTCCTTTCCTGG -3'

Posted On

2014-04-24